Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU119551

Sigma-Aldrich

MISSION® esiRNA

targeting human SOCS3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTTCAGCTCCAAGAGCGAGTACCAGCTGGTGGTGAACGCAGTGCGCAAGCTGCAGGAGAGCGGCTTCTACTGGAGCGCAGTGACCGGCGGCGAGGCGAACCTGCTGCTCAGTGCCGAGCCCGCCGGCACCTTTCTGATCCGCGACAGCTCGGACCAGCGCCACTTCTTCACGCTCAGCGTCAAGACCCAGTCTGGGACCAAGAACCTGCGCATCCAGTGTGAGGGGGGCAGCTTCTCTCTGCAGAGCGATCCCCGGAGCACGCAGCCCGTGCCCCGCTTCGACTGCGTGCTCAAGCTGGTGCACCACTACATGCCGCCCCCTGGAGCCCCCTCCTTCCCCTCGCCACCTACTGAACCCTCCTCCGAGGTGCCCGAGCAGCCGTCTGCCCAGCCACTCCCTGGGAGTCCCCCCAGAAGAGCCTATTACATCTACTCCGGGGGCGAGAAGATCCCCCTGGTGTTGAGCCGGCCCCTCTCCTCCAACGTGGCCACTCTTCAGCATCTCTGTCGGAAGACCGT

Ensembl | nº de acceso humano

ENSG00000184557

Nº de acceso NCBI

NM_003955

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SOCS3(9021) , SOCS3(9021)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
IAV
DAV
EZU
KXU
OWU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ranu Surolia et al.
American journal of physiology. Lung cellular and molecular physiology, 311(5), L928-L940 (2016-11-04)
Pulmonary infections with nontuberculous mycobacteria (P-NTM), such as by Mycobacterium avium complex (M. avium), are increasingly found in the elderly, but the underlying mechanisms are unclear. Recent studies suggest that adaptive immunity is necessary, but not sufficient, for host defense
Naotoshi Iwahara et al.
Journal of Alzheimer's disease : JAD, 55(3), 1235-1247 (2016-11-05)
In response to changes of the central nervous system environment, microglia are capable of acquiring diverse phenotypes for cytotoxic or immune regulation and resolution of injury. Alzheimer's disease (AD) pathology also induces several microglial activations, resulting in production of pro-inflammatory
Mandy Boontanrart et al.
Journal of neuroimmunology, 292, 126-136 (2016-03-06)
Microglia become activated immune cells during infection or disease in the central nervous system (CNS). However, the mechanisms that downregulate activated microglia to prevent immune-mediated damage are not completely understood. Vitamin D3 has been suggested to have immunomodulatory affects, and
Rak-Kyun Seong et al.
Pathogens (Basel, Switzerland), 9(3) (2020-03-04)
Zika virus (ZIKV) is a mosquito-borne flavivirus that has emerged and caused global outbreaks since 2007. Although ZIKV proteins have been shown to suppress early anti-viral innate immune responses, little is known about the exact mechanisms. This study demonstrates that
Yan Zhang et al.
Journal of neuroinflammation, 14(1), 211-211 (2017-11-04)
Morphine tolerance is a clinical challenge, and its pathogenesis is closely related to the neuroinflammation mediated by Toll-like receptor 4 (TLR4). In Chinese pain clinic, lidocaine is combined with morphine to treat chronic pain. We found that lidocaine sufficiently inhibited
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico