Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU110531

Sigma-Aldrich

MISSION® esiRNA

targeting human PPIB

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATGTAGGCCGGGTGATCTTTGGTCTCTTCGGAAAGACTGTTCCAAAAACAGTGGATAATTTTGTGGCCTTAGCTACAGGAGAGAAAGGATTTGGCTACAAAAACAGCAAATTCCATCGTGTAATCAAGGACTTCATGATCCAGGGCGGAGACTTCACCAGGGGAGATGGCACAGGAGGAAAGAGCATCTACGGTGAGCGCTTCCCCGATGAGAACTTCAAACTGAAGCACTACGGGCCTGGCTGGGTGAGCATGGCCAACGCAGGCAAAGACACCAACGGCTCCCAGTTCTTCATCACGACAGTCAAGACAGCCTGGCTAGATGGCAAGCATGTGGTGTTTGGCAAAGTTCTAGAGGGCATGGAGGTGGTGCGGAAGGTGGAGAGCACCAAGACAGACAGCCGGGATAAACCCCTGAAGGATGTGATCATCGCAGACTGCGGCAAGATCGAGGTGGAGAAG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Paulo C M Urbano et al.
Frontiers in immunology, 10, 3047-3047 (2020-02-11)
Maintenance of regulatory T cells CD4+CD25highFOXP3+ (Treg) stability is vital for proper Treg function and controlling the immune equilibrium. Treg cells are heterogeneous and can reveal plasticity, exemplified by their potential to express IL-17A. TNFα-TNFR2 signaling controls IL-17A expression in
Ma Paz Zafra et al.
PloS one, 9(3), e91996-e91996 (2014-03-19)
Suppresors of cytokine signaling (SOCS) proteins regulate cytokine responses and control immune balance. Several studies have confirmed that SOCS3 is increased in asthmatic patients, and SOCS3 expression is correlated with disease severity. The objective of this study was to evaluate
Li Liu et al.
Retrovirology, 8, 94-94 (2011-11-16)
Upon cellular entry retroviruses must avoid innate restriction factors produced by the host cell. For human immunodeficiency virus (HIV) human restriction factors, APOBEC3 (apolipoprotein-B-mRNA-editing-enzyme), p21 and tetherin are well characterised. To identify intrinsic resistance factors to HIV-1 replication we screened
Maria M Caffarel et al.
The Journal of pathology, 231(2), 168-179 (2013-06-15)
Oncostatin M receptor (OSMR) is commonly over-expressed in advanced cervical squamous cell carcinoma (SCC), producing a significantly worse clinical outcome. Cervical SCC cells that over-express OSMR show enhanced responsiveness to the major ligand OSM, which induces multiple pro-malignant effects, including
Roberto A Avelar et al.
Genome biology, 21(1), 91-91 (2020-04-09)
Cellular senescence, a permanent state of replicative arrest in otherwise proliferating cells, is a hallmark of aging and has been linked to aging-related diseases. Many genes play a role in cellular senescence, yet a comprehensive understanding of its pathways is

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico