Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU098571

Sigma-Aldrich

MISSION® esiRNA

targeting human MDM2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTTCCATCACATTGCAACAGATGTTGGGCCCTTCGTGAGAATTGGCTTCCTGAAGATAAAGGGAAAGATAAAGGGGAAATCTCTGAGAAAGCCAAACTGGAAAACTCAACACAAGCTGAAGAGGGCTTTGATGTTCCTGATTGTAAAAAAACTATAGTGAATGATTCCAGAGAGTCATGTGTTGAGGAAAATGATGATAAAATTACACAAGCTTCACAATCACAAGAAAGTGAAGACTATTCTCAGCCATCAACTTCTAGTAGCATTATTTATAGCAGCCAAGAAGATGTGAAAGAGTTTGAAAGGGAAGAAACCCAA

Ensembl | nº de acceso humano

ENSG00000135679

Nº de acceso NCBI

NM_002392

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MDM2(4193) , MDM2(4193)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bin Zhang et al.
Oncotarget, 8(42), 71894-71910 (2017-10-27)
Growing evidence indicates that 14-3-3ζ and yes-associated protein (YAP) substantially promote tumorigenesis and tumor development. However, the regulatory mechanism underlying these two proteins remains unknown. Herein, we report a new regulatory role of 14-3-3ζ in the phosphorylation of YAP and
Chengtao Sun et al.
OncoTargets and therapy, 13, 10475-10487 (2020-10-30)
Cell-division cycle 20 (CDC20) is overexpressed in a variety of tumor cells and is negatively regulated by wild-type p53 (wtp53). Our previous study uncovered that CDC20 was upregulated and associated with poor outcome in diffuse large B-cell lymphoma (DLBCL) based
Yong Tang et al.
OncoTargets and therapy, 12, 2247-2258 (2019-04-17)
Mouse double minute 2 (MDM2) contributes to cancer metastasis and epithelial-mesenchymal transition (EMT). This study aimed to investigate small mothers against decapentaplegic (Smad) signaling in MDM2-mediated EMT in lung adenocarcinoma (LAC). Expression patterns of MDM2 in LAC tissues, adjacent tissues
Lingxin Meng et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 107, 139-145 (2018-08-08)
Vascular endothelial growth factor (VEGF) signaling promotes angiogenesis by stimulating the migration and proliferation of endothelial cells. The aim of this study was to investigate the expression of Survivin and VEGF receptor 1/2/3 (VEGFR 1/2/3) in esophageal carcinoma tissues (ECTs)
Hao Zhao et al.
Inflammation, 40(1), 232-239 (2016-11-14)
Inflammation has been implicated in myocardial infarction (MI). MDM2 associates with nuclear factor-κB (NF-κB)-mediated inflammation. However, the role of MDM2 in MI remains unclear. This study aimed to evaluate the impacts of MDM2 inhibition on cardiac dysfunction and fibrosis after
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico