Saltar al contenido
Merck

EHU020361

Sigma-Aldrich

MISSION® esiRNA

targeting human CUL4A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCTTGTGTGGAGAAACAGCTATTAGGAGAACATTTAACAGCAATTCTGCAGAAAGGGCTCGACCACTTACTGGATGAGAACAGAGTGCCGGACCTCGCACAGATGTACCAGCTGTTCAGCCGGGTGAGGGGCGGGCAGCAGGCGCTGCTGCAGCACTGGAGCGAGTACATCAAGACTTTTGGAACAGCGATCGTAATCAATCCTGAGAAAGACAAAGACATGGTCCAAGACCTGTTGGACTTCAAGGACAAGGTGGACCACGTGATCGAGGTCTGCTTCCAGAAGAATGAGCGGTTCGTCAACCTGATGAAGGAGTCCTTTGAGACGTTCATCAACAAGAGACCCAACAAGCCTGCAGAACTGATCGCAAAGCATGTGGATTCAAAGTTAAGAGCAGGCAACAAAGAAGCCACAGACGAGGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yidan Ren et al.
Respiratory research, 20(1), 84-84 (2019-05-08)
Chronic obstructive pulmonary disease (COPD) is a common respiratory disease with high morbidity and mortality. The most important pathophysiological change of COPD is airway obstruction. Airway obstruction can cause airflow restriction and obstructive ventilation dysfunction. Currently, many studies have shown
B Englinger et al.
British journal of cancer, 116(4), 489-500 (2017-01-18)
Colorectal carcinoma (CRC) is the third most common cancer worldwide. Platinum-based anticancer compounds still constitute one mainstay of systemic CRC treatment despite limitations due to adverse effects and resistance development. Trabectedin has shown promising antitumor effects in CRC, however, again
Laura P Saucedo-Cuevas et al.
Oncotarget, 5(8), 2330-2343 (2014-05-30)
The CUL4A E3 ubiquitin ligase is involved in the regulation of many cellular processes and its amplification and/or overexpression has been observed in breast cancer. The 13q34 amplification, which is associated with the basal-like breast cancer subtype, has been proposed

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico