Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU095981

Sigma-Aldrich

MISSION® esiRNA

targeting human TWF2, RP11-330H6.5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCAGTGTGGAAAGCAAGCACCAGACCCTGCAGGGCCTCGCCTTCCCCCTGCAGCCTGAGGCCCAGCGGGCACTCCAGCAGCTCAAGCAGAAAATGGTCAACTACATCCAGATGAAGCTGGACCTAGAGCGGGAAACCATTGAGCTGGTGCACACAGAGCCCACGGATGTGGCCCAGCTGCCCTCCCGGGTGCCCCGAGATGCTGCCCGCTACCACTTCTTCCTCTACAAGCACACCCATGAGGGCGACCCCCTTGAGTCTGTAGTGTTCATCTACTCCATGCCGGGGTACAAGTGCAGCATCAA

Ensembl | nº de acceso humano

ENSG00000173366

Nº de acceso NCBI

NM_017442

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TWF2(11344) , TLR9(54106)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Misty Good et al.
American journal of physiology. Gastrointestinal and liver physiology, 306(11), G1021-G1032 (2014-04-20)
Necrotizing enterocolitis (NEC) is the leading cause of death from gastrointestinal disease in premature infants and develops partly from an exaggerated intestinal epithelial immune response to indigenous microbes. There has been interest in administering probiotic bacteria to reduce NEC severity
Xiaoling Gu et al.
Free radical biology & medicine, 83, 149-158 (2015-03-17)
An increasing number of studies have focused on the phenomenon that mitochondrial DNA (mtDNA) activates innate immunity responses. However, the specific role of mtDNA in inflammatory lung disease remains elusive. This study was designed to examine the proinflammatory effects of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico