Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU082441

Sigma-Aldrich

MISSION® esiRNA

targeting human DAB2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGGGACTTTGAGTGCCTTTGCCAGTTATTTCAACAGCAAGGTTGGCATTCCTCAGGAGAATGCAGACCATGATGACTTTGATGCTAATCAACTATTGAACAAGATCAATGAACCACCAAAGCCAGCTCCCAGACAAGTTTCCCTGCCAGTTACCAAATCTACTGACAATGCATTTGAGAACCCTTTCTTTAAAGATTCTTTTGGTTCATCACAAGCCTCTGTGGCTTCTTCTCAACCTGTATCTTCTGAGATGTATAGGGATCCATTTGGAAATCCTTTTGCCTAAATTCTGAACTTGGTCTGCAGACCATCCAGAGGAATAAAAAGGTTGGCCTTAGTAGTCAAAAACAAAGCTGATAGCCAGACACGTTCTGATTTCTGCCCTTGTTCCAGCTTTGACGT

Ensembl | nº de acceso humano

ENSG00000153071

Nº de acceso NCBI

NM_001343

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... DAB2(112267931) , DAB2(1601)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yuan Cheng et al.
Journal of experimental & clinical cancer research : CR, 35, 11-11 (2016-01-16)
MicroRNA-106b (miR-106b) was recently identified as an oncogene participating in cancer progression. Transforming growth factor β1(TGF-β1) is an indispensable cytokine regulating the local microenvironment, thereby promoting cervical cancer progression. However, the roles of miR-106b in cervical carcinoma progression and TGF-β1-involvement
Yoshitaka Itami et al.
Diagnostics (Basel, Switzerland), 10(1) (2020-01-24)
Disabled homolog-2 (DAB2) has been reported to be a tumor suppressor gene. However, a number of contrary studies suggested that DAB2 promotes tumor invasion in urothelial carcinoma of the bladder (UCB). Here, we investigated the clinical role and biological function
Mio Nakanishi et al.
Cell, 177(4), 910-924 (2019-04-16)
The assembly of organized colonies is the earliest manifestation in the derivation or induction of pluripotency in vitro. However, the necessity and origin of this assemblance is unknown. Here, we identify human pluripotent founder cells (hPFCs) that initiate, as well as

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico