Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU063721

Sigma-Aldrich

MISSION® esiRNA

targeting human GLMN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGATTTTAGCATCGAAACTAGGAGAAATAAGAATGGCTGTAGAGGAACTTCAGTCTATAATAAAGAGATGTCAAATCCTAGAAGAGCAAGACTTTAAAGAAGAGGATTTTGGCCTATTTCAGTTAGCTGGGCAAAGATGCATAGAAGAAGGGCACACAGACCAGCTATTAGAAATTATTCAAAATGAAAAGAATAAGGTCATCATCAAGAATATGGGCTGGAATCTCGTTGGTCCTGTTGTTCGATGCCTTTTGTGTAAAGATAAAGAGGATAGTAAAAGAAAAGTTTATTTTTTGATCTTTGATTTATTGGTAAAGTTATGCAATCCAAAGGAATTATTGTTGGGTTTGCTTGAACTGATTGAAGAGCCCTCTGGAAAACAGATATCCCAAAGTATTCTTCTTTTGCTTCAGCCA

Ensembl | nº de acceso humano

ENSG00000174842

Nº de acceso NCBI

NM_053274

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... GLMN(11146) , GLMN(11146)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dimitrios Patsouras et al.
Molecular medicine reports, 11(6), 4585-4590 (2015-01-28)
Fibroblast activation protein (FAP), a selective protein for tumor stromal fibroblasts, is expressed in >90% of human epithelial carcinomas. A characteristic feature of pancreatic cancer is an extensive fibrotic or desmoplastic reaction surrounding the primary tumor. The present study aimed
Jochen Tillmanns et al.
Journal of molecular and cellular cardiology, 87, 194-203 (2015-09-01)
Fibroblast activation protein α (FAP) is a membrane-bound serine protease expressed by activated fibroblasts during wound healing in the skin. Expression of FAP after myocardial infarction (MI) and potential effects on cardiac wound healing are largely unknown. MI was induced

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico