Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU053421

Sigma-Aldrich

MISSION® esiRNA

targeting human DDIT3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCCAAAATCAGAGCTGGAACCTGAGGAGAGAGTGTTCAAGAAGGAAGTGTATCTTCATACATCACCACACCTGAAAGCAGATGTGCTTTTCCAGACTGATCCAACTGCAGAGATGGCAGCTGAGTCATTGCCTTTCTCCTTCGGGACACTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAGGACCTGCAAGAGGTCCTGTCTTCAGATGAAAATGGGGGTACCTATGTTTCACCTCCTGGAAATGAAGAGGAAGAATCAAAAATCTTCACCACTCTTGACCCTGCTTCTCTGGCTTGGCTGACTGAGGAGGAGCCAGAACCAGCAGAGGTCACAAGCACCTCCCAGAGCCCTCACTCTCCAGATTCCAGTCAGAGCTCCCTGGCTCAGGAGGAAGAGGAGGAAGACCAAGGGAGAACCAGGAAACGGAAACAGAGTGGTCATTCCCCAG

Ensembl | nº de acceso humano

ENSG00000175197

Nº de acceso NCBI

NM_004083

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... DDIT3(1649) , DDIT3(1649)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ZGU
FGU
QSS
SGT
QAS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Maulasri Bhatta et al.
Cell death & disease, 9(5), 467-467 (2018-04-28)
Persistent vascular injury and degeneration in diabetes are attributed in part to defective reparatory function of angiogenic cells. Our recent work implicates endoplasmic reticulum (ER) stress in high-glucose-induced bone marrow (BM) progenitor dysfunction. Herein, we investigated the in vivo role
Ahmed A Gafar et al.
PeerJ, 4, e2445-e2445 (2016-11-30)
Lithocholic acid (LCA) is a secondary bile acid that is selectively toxic to human neuroblastoma, breast and prostate cancer cells, whilst sparing normal cells. We previously reported that LCA inhibited cell viability and proliferation and induced apoptosis and necrosis of
Lu Fan et al.
Frontiers in pharmacology, 8, 424-424 (2017-07-15)
Hepatocellular carcinoma (HCC) is a malignant primary liver cancer with poor prognosis. In the present study, we report that pekinenin E (PE), a casbane diterpenoid derived from the roots of
Bin Fang et al.
International journal of biological sciences, 14(10), 1221-1231 (2018-08-21)
Purpose: Small cell lung cancer (SCLC) is highly lethal with no effective therapy. Wee1 kinase inhibitor AZD1775 (MK-1775) and mTOR kinase inhibitor MLN0128 (TAK228) are in clinical trials for relapsed SCLC and recurrent lung cancer, respectively. However, there is no
Xiaoqing Guo et al.
Anti-cancer drugs, 28(1), 66-74 (2016-09-08)
Tumor necrosis factor related apoptosis-inducing ligand (TRAIL) is a cytokine that selectively induces apoptosis in many tumor cells while leaving normal cells intact and is thus an attractive candidate for antitumor therapies. This paper reports that the combination of tunicamycin
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico