Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU051131

Sigma-Aldrich

MISSION® esiRNA

targeting human TGFBR1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAAGTCATCACCTGGCCTTGGTCCTGTGGAACTGGCAGCTGTCATTGCTGGACCAGTGTGCTTCGTCTGCATCTCACTCATGTTGATGGTCTATATCTGCCACAACCGCACTGTCATTCACCATCGAGTGCCAAATGAAGAGGACCCTTCATTAGATCGCCCTTTTATTTCAGAGGGTACTACGTTGAAAGACTTAATTTATGATATGACAACGTCAGGTTCTGGCTCAGGTTTACCATTGCTTGTTCAGAGAACAATTGCGAGAACTATTGTGTTACAAGAAAGCATTGGCAAAGGTCGATTTGGAGAAGTTTGGAGAGGAAAGTGGCGGGGAGAAGAAGTTGCTGTTAAGATATTCTCCTCTAGAGAAGAACGTTCGTGGTTCCGTGAGGCAGAGATTT

Ensembl | nº de acceso humano

ENSG00000106799

Nº de acceso NCBI

NM_004612

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TGFBR1(7046) , TGFBR1(7046)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Weitang Liao et al.
Frontiers in physiology, 11, 1093-1093 (2020-10-06)
Renal tubulointerstitial fibrosis is usually the final outcome of various end-stage renal diseases. Recent studies have reported that microRNAs (miRNAs) play an important role in renal fibrosis. However, the biological function of microRNAs in renal fibrosis is complicated and remains
Hilène Lin et al.
Scientific reports, 8(1), 10488-10488 (2018-07-12)
Cartilage loss in osteoarthritis (OA) results from altered local production of growth factors and metalloproteases (MMPs). Furin, an enzyme involved in the protein maturation of MMPs, might regulate chondrocyte function. Here, we tested the effect of furin on chondrocyte catabolism
Lincan Duan et al.
PloS one, 13(7), e0200452-e0200452 (2018-07-12)
In the tumor progression, transforming growth factor β1 (TGFβ1) plays a critical role in tumorigenesis as well as metastasis. It is known that high plasma level of TGFβ1 in patients with advanced non-small cell lung cancer (NSCLC) is correlated with
Kaushal Asrani et al.
The Journal of clinical investigation, 127(11), 4001-4017 (2017-09-26)
Despite its central position in oncogenic intracellular signaling networks, the role of mTORC1 in epithelial development has not been studied extensively in vivo. Here, we have used the epidermis as a model system to elucidate the cellular effects and signaling
Si-Rui Ma et al.
Oncotarget, 6(11), 8807-8821 (2015-04-15)
Anterior gradient protein 2 (AGR2) is a novel biomarker with potential oncogenic role. We sought to investigate the diagnostic and prognostic role of AGR2 on head and neck squamous cell carcinoma (HNSCC) with an emphasis on its correlation of cancer

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico