Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU042481

Sigma-Aldrich

MISSION® esiRNA

targeting human DDB2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGCATCAGTTCGCTTAATGAATTCAATCCCATGGGGGACACGCTGGCCTCTGCAATGGGTTACCACATTCTCATCTGGAGCCAGGAGGAAGCCAGGACACGGAAGTGAGAGACACTAAAGAAGGTGTGGGCCAGACAAGGCCTTGGAGCCCACACATGGGATCAAGTCCTGCAAGCAGAGGTGGCGATTTGTTAAAGGGCCAAAAGTATCCAAGGTTAGGGTTGGAGCAGGGGTGCTGGGACCTGGGGCACTGTGGGACTGGGACACTTTTATGTTAATGCTCTGGACTTGCCTCCAGAGACTGCTCCAGAGTTGGTGACACAGCTGTCCCAAGGGCCCCTCTGTATCTAGCCTGGAACCAAGGTTATCTTGGAACTAAATGACTTTTCTCCTCTCAGTGGGTGG

Ensembl | nº de acceso humano

ENSG00000134574

Nº de acceso NCBI

NM_000107

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... DDB2(1643) , DDB2(1643)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sunbok Jang et al.
Nature structural & molecular biology, 26(8), 695-703 (2019-07-25)
UV-DDB, a key protein in human global nucleotide excision repair (NER), binds avidly to abasic sites and 8-oxo-guanine (8-oxoG), suggesting a noncanonical role in base excision repair (BER). We investigated whether UV-DDB can stimulate BER for these two common forms
Qianzheng Zhu et al.
Mutation research, 776, 16-23 (2015-08-11)
Acetylated histone H3 lysine 56 (H3K56Ac) is one of the reversible histone post-translational modifications (PTMs) responsive to DNA damage. We previously described a biphasic decrease and increase of epigenetic mark H3K56Ac in response to ultraviolet radiation (UVR)-induced DNA damage. Here
Hiroyuki Niida et al.
Nature communications, 8, 16102-16102 (2017-07-19)
HBO1, a histone acetyl transferase, is a co-activator of DNA pre-replication complex formation. We recently reported that HBO1 is phosphorylated by ATM and/or ATR and binds to DDB2 after ultraviolet irradiation. Here, we show that phosphorylated HBO1 at cyclobutane pyrimidine

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico