Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU025821

Sigma-Aldrich

MISSION® esiRNA

targeting human CDKN1B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGTTAACCCGGGACTTGGAGAAGCACTGCAGAGACATGGAAGAGGCGAGCCAGCGCAAGTGGAATTTCGATTTTCAGAATCACAAACCCCTAGAGGGCAAGTACGAGTGGCAAGAGGTGGAGAAGGGCAGCTTGCCCGAGTTCTACTACAGACCCCCGCGGCCCCCCAAAGGTGCCTGCAAGGTGCCGGCGCAGGAGAGCCAGGATGTCAGCGGGAGCCGCCCGGCGGCGCCTTTAATTGGGGCTCCGGCTAACTCTGAGGACACGCATTTGGTGGACCCAAAGACTGATCCGTCGGACAGCCAGACGGGGTTAGCGGAGCAATGCGCAGGAATAAGGAAGCGACCTGCAACCGACGATTCTTCTACTCAAAACAAAAGAGCCAACAGAACAGAAGAAAATGTTTCAGACGGTTCCCCAAATGCCGGTTCTGTGGAGCAGACGCCCAAGAAGCCTGGCCTCAGAAGACGTCAAACGTAAACAGCTCG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Galit Ankri-Eliahoo et al.
Journal of vascular surgery, 63(5), 1351-1359 (2015-02-24)
The natural response to arterial occlusive disease is enlargement of collaterals; however, the molecular factors that control collateralization are not well understood. The gene p27(Kip1) (p27) affects human response to arterial injury. Previous studies have shown that overexpression of p27
Alessandra Verdina et al.
Journal of translational medicine, 6, 27-27 (2008-05-24)
Nonsteroidal anti-inflammatory drugs (NSAIDs) have been proposed for prevention and treatment of a variety of human cancers. Piroxicam, in particular, has been recently shown to exert significant anti-tumoral activity in combination with cisplatin (CDDP) on mesothelioma cells. However, the mechanisms
Huimin Wang et al.
Oncology research, 25(9), 1431-1440 (2017-01-22)
Nasopharyngeal carcinoma (NPC) is a common malignancy of the head and neck that arises from the nasopharynx epithelium and is highly invasive. Cyclin-dependent kinase inhibitor 3 (CDKN3) belongs to the dual-specificity protein phosphatase family, which plays a key role in
Takayuki Satoh et al.
Scientific reports, 6, 27829-27829 (2016-06-11)
Potent anti-cancer compounds FR901464 and its methyl-ketal derivative spliceostatin A (SSA) inhibit cell cycle progression at G1 and G2/M phases. These compounds bind to the spliceosome and inhibit the splicing reaction. However, the molecular mechanism underlying G1 arrest after SSA
Ela Alcántara-Flores et al.
Molecules (Basel, Switzerland), 20(12), 21125-21137 (2015-12-04)
Argentatin B has been shown to inhibit the growth of colon HCT-15, and prostate PC-3 cancer cells. However, the mechanism by which argentatin B inhibits cell proliferation is still unknown. We aimed to investigate the mechanism by which argentatin B

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico