Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU024771

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP11, AP000349.2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCGCCTCTACTGGAAGTTTGACCCTGTGAAGGTGAAGGCTCTGGAAGGCTTCCCCCGTCTCGTGGGTCCTGACTTCTTTGGCTGTGCCGAGCCTGCCAACACTTTCCTCTGACCATGGCTTGGATGCCCTCAGGGGTGCTGACCCCTGCCAGGCCACGAATATCAGGCTAGAGACCCATGGCCATCTTTGTGGCTGTGGGCACCAGGCATGGGACTGAGCCCATGTCTCCTCAGGGGGATGGGGTGGGGTACAACCACCATGACAACTGCCGGGAGGGCCACGCAGGTCGTGGTCACCTGCCAGCGACTGTCTCAGACTGGGCAGGGAGGCTTTGGCATGACTTAAGAGGAAGGGCAGTCTTGGGCCCGCTATGCAGGTCCTGGCAAACCTGGCTGCCCTGTCTCCATCCCTGTCCCTCAGGGTAGCACCATGGCAGGACTGGGGGAACTGGAGTGTCCTTGCTGTATCCCTGTTGTGAGGTTCCTTCC

Ensembl | nº de acceso humano

ENSG00000099953

Nº de acceso NCBI

NM_005940

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MMP11(4320) , MMP11(4320)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rui Jiang et al.
The international journal of biochemistry & cell biology, 102, 1-9 (2018-06-12)
This study aimed at finding the long non-coding RNA (lncRNA), miRNA and mRNA which played critical roles in breast cancer (BrCa) by using mixOmics R package. The BrCa dataset were obtained from TCGA and then analyzed using "DESeq2" R package.
Min Song et al.
Journal of cellular biochemistry, 121(2), 984-995 (2019-09-07)
The dysregulation of miR-125a-3p has been observed in multiple tumor types. Nevertheless, the function of miR-125a-3p in papillary thyroid carcinoma (PTC) is yet to be explored. Herein, we find that miR-125a-3p is markedly downregulated in PTC tissues, and its level

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico