Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU016801

Sigma-Aldrich

MISSION® esiRNA

targeting human TGFB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGCCTGAGGCCGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAAACCCACAACGAAATCTATGACAAGTTCAAGCAGAGTACACACAGCATATATATGTTCTTCAACACATCAGAGCTCCGAGAAGCGGTACCTGAACCCGTGTTGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTCAAGTTAAAAGTGGAGCAGCACGTGGAGCTGTACCAGAAATACAGCAACAATTCCTGGCGATACCTCAGCAACCGGCTGCTGGCACCCAGCGACTCGCCAGAGTGGTTATCTTTTGATGTCACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGGAAATTGAGGGCTTTCGCCTTAGCGCCCACTGCTCCTGTGACAGCAGGGATAACACACTGCAAGTGGACATCAACGGGTTC

Ensembl | nº de acceso humano

ENSG00000105329

Nº de acceso NCBI

NM_000660

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TGFB1(7040) , TGFB1(7040)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Satomi Furukawa et al.
Experimental cell research, 383(1), 111506-111506 (2019-07-22)
NOD-like receptor family, pyrin domain-containing 3 (NLRP3) is one of the key components of the inflammasome. NLRP3 also participates in the regulation of fibrosis independent of the inflammasome. In this study, we analyzed the mechanism of upregulation of NLRP3 expression
Danae E Zamboulis et al.
eLife, 9 (2020-10-17)
Mature connective tissues demonstrate highly specialised properties, remarkably adapted to meet their functional requirements. Tissue adaptation to environmental cues can occur throughout life and poor adaptation commonly results in injury. However, the temporal nature and drivers of functional adaptation remain

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico