Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU008611

Sigma-Aldrich

MISSION® esiRNA

targeting human IFIH1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTGCATGGAGGAGGAACTGTTGACAATTGAAGACAGAAACCGGATTGCTGCTGCAGAAAACAATGGAAATGAATCAGGTGTAAGAGAGCTACTAAAAAGGATTGTGCAGAAAGAAAACTGGTTCTCTGCATTTCTGAATGTTCTTCGTCAAACAGGAAACAATGAACTTGTCCAAGAGTTAACAGGCTCTGATTGCTCAGAAAGCAATGCAGAGATTGAGAATTTATCACAAGTTGATGGTCCTCAAGTGGAAGAGCAACTTCTTTCAACCACAGTTCAGCCAAATCTGGAGAAGGAGGTCTGGGGCATGGAGAATAACTCATCAGAATCATCTTTTGCAGATTCTTCTGTAGTTTCAGAATCAGACACAAGTTTGGCAGAAGGAAGTGTCAGCTGCTTAGATGAAAGTCTTGGACATAACAGCAACATGGGCA

Ensembl | nº de acceso humano

ENSG00000115267

Nº de acceso NCBI

NM_022168

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IFIH1(64135) , IFIH1(64135)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Seung Bum Park et al.
PloS one, 11(7), e0158419-e0158419 (2016-07-13)
Hepatitis C virus (HCV) actively evades host interferon (IFN) responses but the mechanisms of how it does so are not completely understood. In this study, we present evidence for an HCV factor that contributes to the suppression of retinoic-acid-inducible gene-I
Shogo Kawaguchi et al.
Inflammation, 42(6), 2095-2104 (2019-08-24)
The molecular mechanisms of innate immunity are closely associated with the development of non-alcoholic fatty liver disease (NAFLD). TNF-α is a key cytokine involved in the pathogenesis of metabolic inflammation like NAFLD. Melanoma differentiation-associated gene 5 (MDA5) is a member
Chia-Lin Chen et al.
Nature communications, 8, 13882-13882 (2017-01-10)
B-cell infection by hepatitis C virus (HCV) has been a controversial topic. To examine whether HCV has a genetically determined lymphotropism through a co-receptor specific for the infection by lymphotropic HCV, we established an infectious clone and chimeric virus of
Iwona A Buskiewicz et al.
Science signaling, 9(456), ra115-ra115 (2016-12-03)
The increased expression of genes induced by type I interferon (IFN) is characteristic of viral infections and systemic lupus erythematosus (SLE). We showed that mitochondrial antiviral signaling (MAVS) protein, which normally forms a complex with retinoic acid gene I (RIG-I)-like
Tongtian Zhuang et al.
Cell death & disease, 11(6), 453-453 (2020-06-14)
Vitiligo is a disfiguring disease featuring chemokines-mediated cutaneous infiltration of autoreactive CD8+ T cells that kill melanocytes. Copious studies have indicated that virus invasion participates in the pathogenesis of vitiligo. IFIH1, encoding MDA5 which is an intracellular virus sensor, has
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico