Skip to Content
Merck
All Photos(1)

Key Documents

EMU050591

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Socs3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACCTCTCTCCTCCAACGTGGCCACCCTCCAGCATCTTTGTCGGAAGACTGTCAACGGCCACCTGGACTCCTATGAGAAAGTGACCCAGCTGCCTGGACCCATTCGGGAGTTCCTGGATCAGTATGATGCTCCACTTTAAGGAGCAAAAGGGTCAGAGGGGGGCCTGGGTCGGTCGGTCGCCTCTCCTCCGAGGCACATGGCACAAGCACAAAAATCCAGCCCCAACGGTCGGTAGCTCCCAGTGAGCCAGGGGCAGATTGGCTTCTTCCTCAGGCCCTCCACTCCCGCAGAGTAGAGCTGGCAGGACCTGGAATTCGTCTGAGGGGAGGGGGAGCTGCCACCTGCTTTCCCCCCTCCCCCAGCTCCAGCTTCTTTCAAGTGGAGCCAGCCGGCCTGGCCTGGTGGGACAATACCTTTGACAAGCGGACTCTCC

Ensembl | mouse accession no.

ENSMUSG00000053113

NCBI accession no.

NM_007707

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... SOCS3(12702) , Socs3(12702)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shusheng Che et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 6805-6811 (2015-04-05)
Malignant glioma is the most common intracranial tumor with poor prognosis. It is well believed that glioma stem cells (GSCs) are responsible for the initiation and progression of glioma. Janus kinase/signal transducer and activator of transcription (Jak/STAT3) pathway plays a
Gang Xu et al.
Virology, 462-463, 343-350 (2014-07-16)
MiR-221 was reported to be upregulated and play roles in tumorigenesis of hepatitis C virus (HCV) associated hepatocellular carcinoma (HCC). However, the role of miR-221 in HCV infection remains unknown. In this study, it was found that miR-221 was upregulated
E-J Choi et al.
Scandinavian journal of immunology, 82(4), 337-344 (2015-06-16)
Varicella-zoster virus (VZV) is an important viral pathogen that is responsible for causing varicella (chickenpox) and herpes zoster (shingles). VZV has been shown to suppress early anti-viral innate immune responses, but the exact mechanisms are not yet well understood. Here
Whajung Cho et al.
Journal of immunology (Baltimore, Md. : 1950), 194(9), 4287-4297 (2015-04-01)
PGs are emerging as important immune modulators. Since our report on the expression of PG synthases in human follicular dendritic cells, we investigated the potential immunoregulatory function of PGs and their production mechanisms. In this study, we explored the intracellular
Andrea Heldsinger et al.
Endocrinology, 155(10), 3956-3969 (2014-07-26)
The anorexigenic adipocyte-derived hormone leptin and the orexigenic hormone ghrelin act in opposition to regulate feeding behavior via the vagal afferent pathways. The mechanisms by which ghrelin exerts its inhibitory effects on leptin are unknown. We hypothesized that ghrelin activates
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service