Skip to Content
Merck
All Photos(1)

Key Documents

EHU132051

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAGCCAGCGCTACAAAGTTGACTACGAGTCTCAGAGCACAGATACCCAGAACTTCTCCTCCGAGTCCAAGCGGGAGACAGAATATGGTCCCTGCCGTAGAGAAATGGAAGACACACTGAATCACCTGAAGTTCCTCAATGTGCTGAGTCCCAGGGGTGTACACATTCCCAACTGTGACAAGAAGGGATTTTATAAGAAAAAGCAGTGTCGCCCTTCCAAAGGCAGGAAGCGGGGCTTCTGCTGGTGTGTGGATAAGTATGGGCAGCCTCTCCCAGGCTACACCACCAAGGGGAAGGAGGACGTGCACTGCTACAGCATGCAGAGCAAGTAGACGCCTGCCGCAAGGTTAATGTGGAGCTCAAATATGCCTTATTTTGCACAAAAGACTGCCAAGGACATGACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lili Bao et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(11), 15043-15052 (2016-09-24)
Insulin-like growth factor-binding protein-3 (IGFBP3) is an N-linked glycosylated, phosphorylated protein, which has been reported to regulate cancer progression and metastasis. However, the role of IGFBP3 in tumor metastasis remains under debate. Nasopharyngeal carcinoma (NPC) is a highly metastatic head
Wei Zhou et al.
Oncology reports, 37(2), 1075-1083 (2016-12-22)
MicroRNAs play critical roles in the progression of acute lymphoblastic leukemia (ALL). Previous studies have indicated that miR-196b and miR-1290 play critical roles in T-cell ALL (T-ALL) and B-cell ALL (B-ALL), respectively. Resveratrol, a natural edible polyphenolic phytoalexin, possesses certain
Huiwen Wang et al.
Cancer management and research, 12, 1007-1015 (2020-02-28)
Chemotherapeutic treatment of hepatocellular carcinoma (HCC) has always been plagued by nonspecific and side effects. Plant extracts have potential anticancer capabilities with low cytotoxicity and few side effects, but their detailed mechanisms are still unclear, thus limiting their clinical applications.
Chang-Ling Li et al.
Journal of molecular and cellular cardiology, 139, 98-112 (2020-01-27)
Salvianolic acid B (Sal B) is the representative component of phenolic acids derived from the dried root and rhizome of Salvia miltiorrhiza Bge. (Labiatae), which has been widely used for the treatment of cardiovascular and cerebrovascular diseases. However, the effect
Yan He et al.
Fitoterapia, 124, 200-205 (2017-11-21)
Insulin-like growth factor I (IGF-I) and binding protein 3 (IGFBP-3) play a role in the maintenance of gut mucosal barrier function. Nevertheless, IGF-I/IGFBP-3 and tight junction protein (TJP) expression in small intestinal mucosa are often impaired during endotoxemia. In this

Global Trade Item Number

SKUGTIN
EHU132051-20UG4061831364095
EHU132051-50UG4061828458813

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service