Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EMU094061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atg7

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GTTTCTGCTCCTGACCTTCGCGGACCTAAAGAAGTACCACTTCTACTACTGGTTTTGCTGCCCCGCCCTCTGTCTTCCTGAGAGCATCCCTCTAATCCGGGGACCTGTGAGCTTGGATCAAAGGCTTTCACCAAAACAGATCCAGGCCCTGGAGCATGCCTATGATGATCTGTGTCGAGCCGAAGGCGTCACGGCCCTGCCCTACTTCTTATTCAAGTACGATGACGACACTGTTCTGGTCTCCTTGCTCAAACACTACAGTGATTTCTTCCAAGGTCAAAGGACAAAGATAACAGTTGGTGTGTACGATCCCTGTAACCTAGCCCAGTACCCTGGATGGCCTTTGAGGAATTTTTTGGTCCTGGCAGCCCACAGATGGAGCGGCAGTTTCCAGTCCGTTGAAGTCC

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000030314

NCBI-Hinterlegungsnummer

NM_028835

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... ATG7(74244) , Atg7(74244)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Bingrong Tang et al.
PloS one, 9(7), e103364-e103364 (2014-07-26)
The two major intracellular protein degradation systems, the ubiquitin-proteasome system (UPS) and autophagy, work collaboratively in many biological processes including development, apoptosis, aging, and countering oxidative injuries. We report here that, in human retinal pigment epithelial cells (RPE), ARPE-19 cells
Hong-Guang Xia et al.
The Journal of cell biology, 210(5), 705-716 (2015-09-02)
Hexokinase II (HK2), a key enzyme involved in glucose metabolism, is regulated by growth factor signaling and is required for initiation and maintenance of tumors. Here we show that metabolic stress triggered by perturbation of receptor tyrosine kinase FLT3 in
Marco B E Schaaf et al.
Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology, 114(3), 406-412 (2015-03-18)
(Pre)clinical studies indicate that autophagy inhibition increases response to anti-cancer therapies. Although promising, due to contradicting reports, it remains unclear if radiation therapy changes autophagy activity and if autophagy inhibition changes the cellular intrinsic radiosensitivity. Discrepancies may result from different
Hongming Pan et al.
Scientific reports, 4, 6683-6683 (2014-10-21)
Autophagy is a critical survival pathway for cancer cells under conditions of stress. Thus, induction of autophagy has emerged as a drug resistance mechanism. This study is to determine whether autophagy is activated by a novel multikinase inhibitor linifanib, thereby
Rong Zheng et al.
Oncotarget, 6(19), 17417-17429 (2015-05-31)
Radiation therapy has an important role in the treatment of breast cancer. Dysfunction p53 and hypoxia are typical biological characteristics of breast cancer that constitute barriers to the efficacy of radiotherapy. Mitophagy plays a protective role in cellular homeostasis under
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.