Direkt zum Inhalt
Merck

EHU062171

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GAGCCAAGCATAAGGTCTGCCGAAGCCTTGGCGTTCTCAGACTGCCGGCTGCACATCTGCCTGTACTACCGGGAAATCCTCGTGAAGGAGCTGACCACGTCCAGCCCCGAGGGCTGCCGGATCTCCCATGGACATACGTATGACGCCAGCAACCTGGACCAGGTCCTGTTCCCCTACCCAGAGGACAATGGCCAGAGGAAAAACATTGAGAAGCTGCTGAGCCACCTGGAGAGGGGCGTGGTCCTCTGGATGGCCCCCGACGGGCTCTATGCGAAAAGACTGTGCCAGAGCAGGATCTACTGGGACGGGCCCCTGGCGCTGTGCAACGACCGGCCCAACAAACTGGAGAGAGACCAGACCTGCAAGCTCTTTGACACACAGCAGTTCTTGTCAGAGCTGCAAGCGTTTGCTCACCACGGCCGCTCCCTGCCAAGATTCCAGGTGACTCTATGCTTTGGAGAGGAGTTTCCAGACCC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Takuya Yashiro et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(10), 11481-11491 (2019-07-18)
C-C chemokine receptor type 7 (CCR7) is essential for migration of dendritic cells (DCs) to draining lymph nodes. PU.1/Spi1 is a transcription factor playing a critical role in the gene regulation of DCs. PU.1 knockdown decreased the expression of CCR7
Takuya Yashiro et al.
Scientific reports, 9(1), 1161-1161 (2019-02-06)
The chemokine CCL22 is predominantly produced by dendritic cells (DCs) and macrophages. CCL22 acts on CCR4-expressing cells including Th2 and Treg. Although a correlation between the CCL22-CCR4 axis and allergic diseases has been established, the mechanism of monocyte lineage-specific Ccl22
T Watanabe et al.
Mucosal immunology, 7(6), 1312-1325 (2014-03-29)
It is well established that polymorphisms of the caspase activation and recruitment domain 15 (CARD15) gene, a major risk factor in Crohn's disease (CD), lead to loss of nucleotide-binding oligomerization domain 2 (NOD2) function. However, a molecular explanation of how
Sorim Nam et al.
Journal of leukocyte biology, 100(6), 1273-1284 (2016-09-08)
Myeloid-derived suppressor cells (MDSCs) are immature cells that do not differentiate into mature myeloid cells. Two major populations of PMN-MDSCs (Ly6G
Masanori Nagaoka et al.
Journal of immunology (Baltimore, Md. : 1950), 199(8), 2958-2967 (2017-09-13)
NR4A3/NOR1 belongs to the NR4A subfamily of the nuclear hormone receptor superfamily, which is activated in a ligand-independent manner. To examine the role of NR4A3 in gene expression of dendritic cells (DCs), we introduced NR4A3 small interfering RNA (siRNA) into

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.