Direkt zum Inhalt
Merck

EHU053481

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK9

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TACGAGAAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAGACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCCATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAACTTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATACCTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAGTTCACGCTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATCCACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGATGGGGTCCTGAAGCTGGCAGACTTT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jinglu Wang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(5), 5990-6000 (2019-02-07)
Despite surgical and chemotherapeutic advances over the past few decades, the prognosis for ovarian cancer remains very poor. Although cyclin-dependent kinase (CDK) 9 has an established pathogenic role in various cancers, its function in ovarian cancer remains poorly defined. The
So-Young Kim et al.
PloS one, 10(12), e0146073-e0146073 (2016-01-01)
Breast cancer cells generally develop resistance to TNF-Related Apoptosis-Inducing Ligand (TRAIL) and, therefore, assistance from sensitizers is required. In our study, we have demonstrated that Spleen tyrosine kinase (Syk) inhibitor Bay 61-3606 was identified as a TRAIL sensitizer. Amplification of
Muhammed H Rahaman et al.
Molecular oncology, 13(10), 2178-2193 (2019-08-10)
Colorectal cancer (CRC) remains one of the most lethal human malignancies, and pursuit of new therapeutic targets for treatment has been a major research focus. Cyclin-dependent kinase 9 (CDK9), which plays a crucial role in transcription, has emerged as a
Nicole Pinto et al.
PloS one, 15(9), e0239315-e0239315 (2020-09-25)
Anaplastic thyroid cancer (ATC) is a rare, but nearly uniformly fatal disease that is typically resistant to chemotherapy and radiation. Alternative strategies to target this cancer at a molecular level are necessary in order to improve dismal outcomes for ATC
Hangzhan Ma et al.
EBioMedicine, 39, 182-193 (2018-12-24)
Cyclin-dependent protein kinase 9 (CDK9) has been shown to play an important role in the pathogenesis of malignant tumors. However, the expression and function of CDK9 remain unknown in osteosarcomas. The purpose of this study is to assess the expression

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.