Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EMU201981

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Akr1b3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGCCGTGAAAGTTGCTATTGACTTGGGGTACCGCCACATTGACTGCGCCCAGGTGTACCAGAATGAGAAGGAGGTGGGAGTGGCCCTCCAGGAGAAGCTCAAGGAGCAGGTGGTGAAGCGGCAGGATCTCTTCATTGTCAGCAAGCTGTGGTGCACGTTCCATGACAAGAGCATGGTGAAAGGAGCCTTCCAGAAGACACTGAGCGACCTGCAGCTGGACTACCTGGATCTCTACCTTATTCACTGGCCAACGGGGTTCAAGCCTGGGCCCGACTATTTCCCACTGGATGCCTCAGGGAACGTGATACCTAGTGACACCGATTTTGTGGACACTTGGA

N° accesso Ensembl | topo

ENSMUSG00000001642

N° accesso NCBI

NM_009658

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... AKR1B3(11677) , Akr1b3(11677)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Valerie N Barton et al.
Molecular cancer therapeutics, 14(3), 769-778 (2015-02-26)
Triple-negative breast cancer (TNBC) has the lowest 5-year survival rate of invasive breast carcinomas, and currently there are no approved targeted therapies for this aggressive form of the disease. The androgen receptor (AR) is expressed in up to one third
Xianwei Li et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 19(5), 401-411 (2015-09-04)
Aldose reductase (AR) is known to play a crucial role in the mediation of diabetic and cardiovascular complications. Recently, several studies have demonstrated that allergen-induced airway remodeling and ovalbumin-induced asthma is mediated by AR. Epalrestat is an aldose reductase inhibitor
Tao Shan et al.
Cancer science, 105(7), 847-856 (2014-05-13)
Norepinephrine and epinephrine, catecholamine hormones that are major mediators for chronic stress-induced cancers, are implicated in the progression of a number of cancer cells, including gastric adenocarcinoma. However, the underlying mechanisms of these hormones have not been well elucidated. Epithelial-mesenchymal
Xiaolong Du et al.
Experimental biology and medicine (Maywood, N.J.), 240(11), 1472-1479 (2015-05-15)
Angiogenesis is critical to wound repair due to its role in providing oxygen and nutrients that are required to support the growth and function of reparative cells in damaged tissues. Adenosine receptors are claimed to be of paramount importance in
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.