Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU170821

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Birc5

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCAAAGGAGACCAACAACAAGCAAAAAGAGTTTGAAGAGACTGCAAAGACTACCCGTCAGTCAATTGAGCAGCTGGCTGCCTAATGCTGAGCCTTTGCTGAGATAACTTGGACCTGAGTGACATGCCACATCTAAGCCACGCATCCCAGCTTTTCCAGCCAGGGCCTCCTAGCAGGATCTTAGAGAAGGAGACAGTGGTATTTTGAAACTGGATATCAAATATTTTTGGTTTTGCTTTAAAGTGGCTACCTCTCTTTGGTTTTGTGGCTTTGCTCTATTGTGACGTGGACTTAAGCAATAAGGAAGTGATGAAGGGACAGTGTTCTCTGACAGGACCTGTGGGGGTCGGGGTGCCTGTGCAAGGTCTTGGTTCTGATTGTGATATTTCCATACAGGGCTGCTAATGCAGCCCATGGGTAAGTGTGGTTATATGTGTTTGTGCTGATAATTTTGTCCTGATGAGTTTTCCTACCACGGGGTAACGG

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Eloïse Véquaud et al.
Breast cancer research and treatment, 155(1), 53-63 (2015-12-19)
Survivin overexpression, frequently found in breast cancers and others, is associated with poor prognosis. Its dual regulation of cell division and apoptosis makes it an attractive therapeutic target but its exact functions that are required for tumor maintenance are still
Sanam Arami et al.
Current pharmaceutical design, 23(16), 2400-2409 (2016-11-02)
Targeted delivery of small interfering RNA (siRNA) to the specific tumor tissues and cells is the key challenge in the development of RNA interference as a therapeutic application. To target breast cancer, we developed a cationic nanoparticle as a therapeutic
Yongping Cai et al.
International journal of clinical and experimental pathology, 8(10), 13267-13272 (2016-01-02)
Survivin, a member of the inhibitor of apoptosis gene family regulates two critical processes in neoplastic transformation, namely, cell proliferation and apoptosis. This study aimed to detect the effect of survivin on tumor growth of colorectal cancer (CRC) in vivo.
Elisabetta Palazzo et al.
International journal of molecular sciences, 16(11), 26291-26302 (2015-11-06)
The Notch signaling pathway orchestrates cell fate by either inducing cell differentiation or maintaining cells in an undifferentiated state. This study aims to evaluate Notch expression and function in normal human keratinocytes. Notch1 is expressed in all epidermal layers, though
Yuhuan Li et al.
Pakistan journal of pharmaceutical sciences, 28(5 Suppl), 1887-1890 (2015-11-04)
Breast cancer resistance to therapy can result from expression of antiapoptotic genes. Survivin is an antiapoptotic gene that is over expressed in most human tumors. RNA interference using short interfering RNA (siRNA) can be used to specifically inhibit survivin expression.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.