Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EMU150581

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Camk2a

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCTGAGAGCACCAACACCACCATTGAGGACGAAGACACCAAAGTGCGCAAACAGGAAATTATCAAAGTGACAGAGCAGCTGATCGAAGCCATAAGCAATGGAGACTTTGAGTCCTACACGAAGATGTGCGACCCTGGAATGACAGCCTTTGAACCAGAGGCCCTGGGGAACCTGGTGGAGGGCCTGGACTTTCATCGATTCTATTTTGAAAACCTGTGGTCCCGGAACAGCAAGCCCGTGCACACCACCATCCTGAACCCTCACATCCACCTGATGGGTGACGAGTCAGCCTGCATCGCCTATATCCGCATCACTCAGTACCTGGATGCAGGCGGCATACCCCGCACGGCCCAGTCAGAGGAGACCCGCGTCTGGCACCGCAGGGACGGCAAATGGCAGATCGTCCACTTCCACAGATCTGGGGCGCCCTCCGTCCTGCCGCATTGAAGGACCAGGCCAGGGTCCCTGCGTCCTTGCTTCGCAGAGATCCGCTCTTTGTCCGTGGAATGT

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Tae-Kyung Kim et al.
Neurobiology of disease, 79, 59-69 (2015-04-29)
Physical exercise is considered beneficial in the treatment of depression, but the underlying mechanism is not clearly understood. In the present study, we investigated the mechanism regulating antidepressant effects of exercise by focusing on the role of the amygdala using
Jie-Min Jia et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 34(41), 13725-13736 (2014-10-10)
Dysbindin is a schizophrenia susceptibility gene required for the development of dendritic spines. The expression of dysbindin proteins is decreased in the brains of schizophrenia patients, and neurons in mice carrying a deletion in the dysbindin gene have fewer dendritic
Xueyuan Zhou et al.
Immunology, 143(2), 287-299 (2014-04-30)
Prostaglandin E2 (PGE2 ) is an important inducer of inflammation, which is also closely linked to the progress of tumours. In macrophages, PGE2 production is regulated by arachidonic acid release and cyclooxygenase-2 (COX-2) expression. In the present study, we found
Luan Pereira Diniz et al.
Glia, 62(12), 1917-1931 (2014-07-22)
The balance between excitatory and inhibitory synaptic inputs is critical for the control of brain function. Astrocytes play important role in the development and maintenance of neuronal circuitry. Whereas astrocytes-derived molecules involved in excitatory synapses are recognized, molecules and molecular
Paul G Daft et al.
PloS one, 10(4), e0121568-e0121568 (2015-04-11)
Osteosarcoma (OS) is a hyperproliferative malignant tumor that requires a high vascular density to maintain its large volume. Vascular Endothelial Growth Factor (VEGF) plays a crucial role in angiogenesis and acts as a paracrine and autocrine agent affecting both endothelial

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.