Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EMU092131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ube2i

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTCCCAACAAAGAACCCTGATGGCACAATGAACCTGATGAACTGGGAGTGCGCTATCCCTGGAAAGAAGGGGACTCCATGGGAAGGAGGCTTGTTCAAGCTACGGATGCTTTTCAAAGATGACTATCCGTCCTCACCACCAAAATGTAAATTTGAGCCCCCACTGTTTCATCCAAACGTGTATCCTTCTGGCACAGTGTGCCTGTCCATCCTGGAGGAAGACAAGGACTGGAGGCCAGCTATCACCATCAAACAGATCTTATTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGACCCAGCTCAAGCAGAGGCCTACACAATTTACTGCCAAAACAGAGTGGAATATGAGAAAAGGGTCCGAGCACAAGCGAAGAAGTTTGCCCCCTCATAAGCAGCGGCCCTGGGCTCCATGACGAGGAAGGGATTGGCTTGGCAAGAACTTG

N° accesso Ensembl | topo

ENSMUSG00000015120

N° accesso NCBI

NM_011665

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... UBE2I(22196) , Ube2i(22196)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Marcel Kunadt et al.
Acta neuropathologica, 129(5), 695-713 (2015-03-18)
Extracellular α-Synuclein has been implicated in interneuronal propagation of disease pathology in Parkinson's Disease. How α-Synuclein is released into the extracellular space is still unclear. Here, we show that α-Synuclein is present in extracellular vesicles in the central nervous system.
Tanya M Spektor et al.
PloS one, 6(7), e22785-e22785 (2011-08-11)
PR-Set7/Set8/KMT5a is a chromatin-modifying enzyme that specifically monomethylates lysine 20 of histone H4 (H4K20me1). In this study we attempted to identify PR-Set7-interacting proteins reasoning that these proteins would provide important insights into the role of PR-Set7 in transcriptional regulation. Using
Xingyue He et al.
PloS one, 10(4), e0123882-e0123882 (2015-04-11)
SUMOylation is a post-translational ubiquitin-like protein modification pathway that regulates important cellular processes including chromosome structure, kinetochore function, chromosome segregation, nuclear and sub-nuclear organization, transcription and DNA damage repair. There is increasing evidence that the SUMO pathway is dysregulated in
Faxin Li et al.
Inflammation, 37(4), 1134-1141 (2014-02-18)
Rheumatoid arthritis (RA) is a chronic autoimmune disease with high morbidity and mortality. Fibroblast-like synoviocytes (FLS) in the synovial tissues play critical roles in joint destruction. Recent studies implicate the sumoylation in the regulation of the inflammation and arthritis. Thus

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.