Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU079511

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atf4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCGATGCTCTGTTTCGAATGGATGACCTGGAAACCATGCCAGATGAGCTCTTGACCACGTTGGATGACACATGTGATCTTTTTGCCCCTCTAGTCCAAGAGACTAATAAGGAGCCCCCTCAGACAGTGAACCCAATTGGCCATCTCCCAGAAAGTTTAATAAAAGTCGACCAGGTTGCCCCCTTTACATTCTTGCAGCCTTTCCCCTGTTCCCCAGGGGTTCTGTCTTCCACTCCAGAGCATTCCTTTAGTTTAGAGCTAGGCAGTGAAGTTGATATCTCTGAAGGAGACAGGAAGCCTGACTCTGCTGCTTACATTACTCTAATCCCTCCATGTGTAAAGGAGGAAGACACTCCCTCTGACAATGACAGTGGCATCTGTATGAGCCCGGAGTCCTACCTGGGCTCTCCCCAGCATAGCCCCTCCACCTCCAGGGCCCCACCAGACAATCTGCCTTCTCCAGG

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Hui Zhang et al.
Journal of translational medicine, 13, 178-178 (2015-06-05)
Anti-dsDNA antibodies play an important role in the pathogenesis of lupus nephritis (LN). Endoplasmic reticulum (ER) stress is a physical reaction under stressful condition and can cause inflammation when stimulation is sustained. This study investigated the roles of ER stress
Kyong-Jin Jung et al.
Oncotarget, 6(3), 1556-1568 (2015-01-19)
Carnosic acid is a phenolic diterpene from rosmarinus officinalis, and has multiple functions, such as anti-inflammatory, anti-viral, and anti-tumor activity. In this study, we examined whether carnosic acid could sensitize TRAIL-mediated apoptosis in human renal carcinoma Caki cells. We found
Enni Markkanen et al.
Nucleic acids research, 43(7), 3667-3679 (2015-03-25)
Genetic instability, provoked by exogenous mutagens, is well linked to initiation of cancer. However, even in unstressed cells, DNA undergoes a plethora of spontaneous alterations provoked by its inherent chemical instability and the intracellular milieu. Base excision repair (BER) is
Shu Wang et al.
Molecular cancer therapeutics, 14(4), 877-888 (2015-01-24)
We previously reported that a pan-PAD inhibitor, YW3-56, activates p53 target genes to inhibit cancer growth. However, the p53-independent anticancer activity and molecular mechanisms of YW3-56 remain largely elusive. Here, gene expression analyses found that ATF4 target genes involved in
Souvik Dey et al.
The Journal of clinical investigation, 125(7), 2592-2608 (2015-05-27)
The integrated stress response (ISR) is a critical mediator of cancer cell survival, and targeting the ISR inhibits tumor progression. Here, we have shown that activating transcription factor 4 (ATF4), a master transcriptional effector of the ISR, protects transformed cells

Global Trade Item Number

SKUGTIN
EMU079511-20UG4061831348545
EMU079511-50UG4061831401196

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.