Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EMU077671

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sod2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AAGGAGCAAGGTCGCTTACAGATTGCTGCCTGCTCTAATCAGGACCCATTGCAAGGAACAACAGGCCTTATTCCGCTGCTGGGGATTGACGTGTGGGAGCACGCTTACTACCTTCAGTATAAAAACGTCAGACCTGACTATCTGAAAGCTATTTGGAATGTAATCAACTGGGAGAATGTTACTGAAAGATACACAGCTTGCAAGAAGTGAAACCTCACTCACGGCCACATTGAGTGCCAGGCTCCGGGCTGGTTTATAGTAGTGTAGAGCATTGCAGCACTATGACTGGGGTGCTGTAGTCTTTATTGATGTCTTTCCACATACCTGATAATTCTATGATAATTTCTTATTTTAATTAAATCTATTCTTAGGCAACTATTTGAGAACAGCGCATACTCTGTGTGAATTGCTCTTGATTGAACATTTTCGTTAGAGCCTTGAATTGCTTGGA

N° accesso Ensembl | topo

ENSMUSG00000006818

N° accesso NCBI

NM_013671

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... SOD2(20656) , Sod2(20656)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Y Xu et al.
Oncogene, 34(32), 4229-4237 (2014-11-05)
Manganese superoxide dismutase (MnSOD) is a mitochondrially localized primary antioxidant enzyme, known to be essential for the survival of aerobic life and to have important roles in tumorigenesis. Here, we show that MnSOD deficiency in skin tissues of MnSOD-heterozygous knockout
Vonetta M Williams et al.
Journal of virology, 88(12), 6751-6761 (2014-04-04)
High-risk types of human papillomavirus (HPV) are the causative agents of virtually all cases of cervical cancer and a significant proportion of other anogenital cancers, as well as both oral and pharyngeal cancers. The high-risk types encode two viral oncogenes
Jiahong Sun et al.
Molecular pharmacology, 88(3), 437-449 (2015-06-18)
Oxidative stress is linked to mitochondrial dysfunction in aging and neurodegenerative conditions. The transcription factor nuclear factor E2-related factor 2 (Nrf2)-antioxidant response element (ARE) regulates intracellular antioxidative capacity to combat oxidative stress. We examined the effect of tert-butylhydroquinone (tBHQ), an
Yasuhiro Ishihara et al.
The Journal of biological chemistry, 290(37), 22805-22817 (2015-08-02)
Microglia are activated quickly in response to external pathogens or cell debris and clear these substances via the inflammatory response. However, excessive activation of microglia can be harmful to host cells due to the increased production of reactive oxygen species
Sabrina Krautbauer et al.
Molecular and cellular biochemistry, 393(1-2), 69-76 (2014-04-18)
Adipogenesis is associated with the upregulation of the antioxidative enzyme manganese superoxide dismutase (MnSOD) suggesting a vital function of this enzyme in adipocyte maturation. In the current work, MnSOD was knocked-down with small-interference RNA in preadipocytes to study its role

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.