Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU071921

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stat1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTGACGACCCTAAGCGAACTGGATACATCAAGACTGAGTTGATTTCTGTGTCTGAAGTCCACCCTTCTAGACTTCAGACCACAGACAACCTGCTTCCCATGTCTCCAGAGGAGTTTGATGAGATGTCCCGGATAGTGGGCCCCGAATTTGACAGTGTGATGAGCACAGTATAAACACGAATTTCTCTCTGGCGACATTTTTTTCCCATCTGTGATTCCTTCCTGCTACTGTTCCTTCATATGCAGTATTTCTAGGGAAATGCAAGAAAGAAAGAGCATCACATTTGCTGAGCACTGCTGGTAGAAAGTGGATATTTCTCTAATTAGAAACCTGTTACTCTGAAGGACTTCATGCATCTTACTGAAGGTGAAATGGAAAGTCACTTAACACAAAATGGATTTTGTAAACAAAGACCAAGAGATCCACCCAA

N° accesso Ensembl | topo

ENSMUSG00000026104

N° accesso NCBI

NM_009283

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... STAT1(20846) , Stat1(20846)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

6-Dehydrogingerdione restrains lipopolysaccharide-induced inflammatory responses in RAW 264.7 macrophages.
Huang SH, Lee CH, Wang HM, et al.
Journal of Agricultural and Food Chemistry, 62(37), 9171-9179 (2014)
Huachen Gan et al.
Scientific reports, 5, 17916-17916 (2015-12-09)
Influenza A virus (IAV) targets airway epithelial cells and exploits the host cell machinery to replicate, causing respiratory illness in annual epidemics and pandemics of variable severity. The high rate of antigenic drift (viral mutation) and the putative antigenic shift
Chaoyong He et al.
Nature communications, 6, 7770-7770 (2015-07-18)
Platelet-derived growth factor (PDGF) is a mitogen and chemoattractant for vascular smooth muscle cells (VSMCs). However, the direct effects of PDGF receptor β (PDGFRβ) activation on VSMCs have not been studied in the context of atherosclerosis. Here we present a
Shunsuke Fukuyo et al.
Rheumatology (Oxford, England), 53(7), 1282-1290 (2014-03-07)
The mechanisms of ectopic calcification in inflammatory diseases are poorly understood. We investigated the effects of inflammatory cytokines on the mechanisms of calcification in human adipose tissue-derived mesenchymal stem cells (hADSCs). The effects of inflammatory cytokines were evaluated using hADSCs

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.