Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU063061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse C3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GACGCCACTATGTCCATCCTGGACATCTCCATGATGACTGGCTTTGCTCCAGACACAAAGGACCTGGAACTGCTGGCCTCTGGAGTAGATAGATACATCTCCAAGTACGAGATGAACAAAGCCTTCTCCAACAAGAACACCCTCATCATCTACCTAGAAAAGATTTCACACACCGAAGAAGACTGCCTGACCTTCAAAGTTCACCAGTACTTTAATGTGGGACTTATCCAGCCCGGGTCGGTCAAGGTCTACTCCTATTACAACCTCGAGGAATCATGCACCCGGTTCTATCATCCAGAGAAGGACGATGGGATGCTCAGCAAGCTGTGCCACAGTGAAATGTGCCGGTGTGCTGAAGAGAACTGCTTCATGCAACAGTCACAGGAGAAGATCAACCTGAATGTCCGG

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Eva-Maria Nichols et al.
Kidney international, 88(6), 1314-1322 (2015-07-30)
Abnormal regulation of the complement alternative pathway is associated with C3 glomerulopathy. Complement factor H is the main plasma regulator of the alternative pathway and consists of 20 short consensus repeat (SCR) domains. Although recombinant full-length factor H represents a
Hiroyuki Inoshita et al.
PloS one, 8(11), e78736-e78736 (2013-11-14)
The link between glomerular IgA nephropathy (IgAN) and T helper 2 (Th2) response has been implicated, however, the mechanisms are poorly defined because of the lack of an appropriate model. Here we report a novel murine model characterized by lineage-restricted
Manuela Veglia et al.
American journal of reproductive immunology (New York, N.Y. : 1989), 74(6), 542-552 (2015-09-22)
A threefold higher prevalence of antinuclear antibodies (ANA) has been reported in patients with recurrent pregnancy loss (RPL). Nevertheless, the role of ANA in reproductive failure is still unclear. The aim of this study was to investigate the role of
Maria I Fonseca et al.
Journal of neuroinflammation, 8(1), 4-4 (2011-01-18)
Complement proteins and activation products have been found associated with neuropathology in Alzheimer's disease (AD). Recently, a C5a receptor antagonist was shown to suppress neuropathology in two murine models of AD, Tg2576 and 3xTg. Previously, a genetic deficiency of C1q
Masanori A Murayama et al.
Nature communications, 6, 8483-8483 (2015-09-26)
The complement system is important for the host defence against infection as well as for the development of inflammatory diseases. Here we show that C1q/TNF-related protein 6 (CTRP6; gene symbol C1qtnf6) expression is elevated in mouse rheumatoid arthritis (RA) models.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.