Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU045141

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdh1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTTGGTGTGGGTCAGGAAATCACATCTTATACCGCTCGAGAGCCGGACACGTTCATGGATCAGAAGATCACGTATCGGATTTGGAGGGACACTGCCAACTGGCTGGAGATTAACCCAGAGACTGGTGCCATTTTCACGCGCGCTGAGATGGACAGAGAAGACGCTGAGCATGTGAAGAACAGCACATATGTAGCTCTCATCATCGCCACAGATGATGGTTCACCCATTGCCACTGGCACGGGCACTCTTCTCCTGGTCCTGTTAGACGTCAATGACAACGCTCCCATCCCAGAACCTCGAAACATGCAGTTCTGCCAGAGGAACCCACAGCCTCATATCATCACCATCTTGGATCCAGACCTTCCCCCCAACACGTCCCCCTTTACTGCTGAGCTAACCCATGGGGCCAGCGTCAACTGGACCATTGAGTATAATGACGCAGCTCAAGAATCTCTCATTTTGCAACCAAGAAAGGACTTAGAGATTGGCGAATACAAAATCCATCTCAAGCTCGCGGATAACCAGAACAAAGACCAGGTGACCACGTTGGACGTCCATGTGTGTGACTGTGAAGGGACGGTCAAC

N° accesso Ensembl | topo

ENSMUSG00000000303

N° accesso NCBI

NM_009864

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... CDH1(12550) , Cdh1(12550)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
LST
BET
DCT
YQS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Anchalee Techasen et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(9), 8645-8652 (2014-05-29)
Tumor progression is characterized by loss of cell adhesion and increase of invasion and metastasis. E-cadherin, a cell adhesion molecule, is frequently downregulated and has been proposed as an important mediator in epithelial-mesenchymal transition (EMT) in tumors. In this study
Vikas Bhardwaj et al.
Oncotarget, 6(3), 1531-1543 (2015-01-22)
H. pylori infection is the strongest known risk factor for gastric cancer. Inhibition of host tumor suppressor mechanisms by the bacteria underlies the development of this disease. Among the tumor suppressors affected by H. pylori are p53 and E-cadherin, which
Svetlana N Rubtsova et al.
PloS one, 10(7), e0133578-e0133578 (2015-07-25)
Using confocal microscopy, we analyzed the behavior of IAR-6-1, IAR1170, and IAR1162 transformed epithelial cells seeded onto the confluent monolayer of normal IAR-2 epithelial cells. Live-cell imaging of neoplastic cells stably expressing EGFP and of normal epithelial cells stably expressing
Chunyan Zhao et al.
Cancer research, 74(14), 3983-3994 (2014-05-17)
Triple-negative breast cancer (TNBC) is an aggressive clinical subtype accounting for up to 20% of all breast cancers, but its malignant determinants remain largely undefined. Here, we show that in TNBC the overexpression of Fra-1, a component of the transcription

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.