Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EMU001091

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Elavl1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCCTCAGAACATGACCCAAGAGGAACTACGAAGTCTGTTCAGCAGCATTGGCGAGGTTGAATCTGCAAAGCTTATTCGGGATAAAGTAGCAGGACACAGCTTGGGCTACGGTTTTGTGAACTATGTGACTGCAAAAGATGCAGAGAGAGCAATCAGCACACTGAACGGCTTGAGACTCCAGTCCAAAACCATTAAGGTGTCATATGCTCGCCCAAGCTCAGAGGTCATCAAAGATGCCAACTTATACATCAGTGGGCTCCCAAGGACCATGACACAGAAGGATGTGGAAGACATGTTTTCTCGGTTTGGGCGAATCATCAACTCCAGGGTCCTTGTGGATCAGACCACAGGTTTGTCCAGAGGGGTTGCCTTTATCCGGTTTGACAAACGGTCAGAAGCAG

N° accesso Ensembl | topo

ENSMUSG00000040028

N° accesso NCBI

NP_034615

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... ELAVL1(15568) , Elavl1(15568)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Danping Wu et al.
Clinical laboratory, 61(11), 1625-1634 (2016-01-07)
Increasing evidence suggests that microRNAs are widely involved in cancer progression and metastasis. However, the specific role of miR-31 in papillary thyroid carcinoma (PTC) is still largely unknown. The level of miR-31 and HuR was detected in 30 pairedcancerous and
Kotb Abdelmohsen et al.
Nucleic acids research, 42(15), 10099-10111 (2014-08-16)
Noncoding RNAs (ncRNAs) and RNA-binding proteins are potent post-transcriptional regulators of gene expression. The ncRNA 7SL is upregulated in cancer cells, but its impact upon the phenotype of cancer cells is unknown. Here, we present evidence that 7SL forms a
Kenneth K W To et al.
Experimental cell research, 338(2), 222-231 (2015-09-20)
Colorectal cancer (CRC) is a major cause of mortality and morbidity worldwide. While surgery remains the mainstay of treatment for early stage CRC, adjuvant chemotherapy is usually given to reduce the risk of recurrence after colectomy. Overexpression of a multidrug
Stephen M Kraynik et al.
Biochimica et biophysica acta, 1849(6), 688-696 (2015-03-03)
Heat shock protein 70.3 (Hsp70.3) expression increases in response to cellular stress and plays a cytoprotective role. We have previously shown that Hsp70.3 expression is controlled through coordinated post-transcriptional regulation by miRNAs and alternative polyadenylation (APA), and APA-mediated shortening of
Jeong-Dan Cha et al.
Head & neck, 36(8), 1168-1175 (2013-07-16)
HuR expression has been noted in several cancer types, in which it may contribute to increased expression of cellular inhibitors of apoptosis protein-2 (cIAP2) observed during tumorigenesis. To assess the correlation between cIAP2 and HuR in cases of oral squamous
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.