Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU228771

Sigma-Aldrich

MISSION® esiRNA

targeting human USP17L2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CGGGATTTCAGACACTTTTGACCCTTACCTGGACATCGCCCTGGATATCCAGGCAGCTCAGAGTGTCAAGCAAGCTTTGGAACAGTTGGTGAAGCCCGAAGAACTCAATGGAGAGAATGCCTATCATTGCGGTCTTTGTCTCCAGAGGGCGCCGGCCTCCAAGACGTTAACTTTACACACTTCTGCCAAGGTCCTCATCCTTGTCTTGAAGAGATTCTCCGATGTCACAGGCAACAAACTTGCCAAGAATGTGCAATATCCTGAGTGCCTTGACATGCAGCCATACATGTCTCAGCAGAACACAGGACCTCTTGTCTATGTCCTCTATGCTGTGCTGGTCCACGCTGGGTGGAGTTGTCACGACGGACATTACTTCTCTTATGTCAAAGCTCAAGAAGGCCAGTGGTATAAAATGGATGATGCCAAGGTCACTGCCTGTAGCATCACTTCTGTCCTGAGTCAACAGGCCTATGTCCTCTTTTACATCCAGAAGAGTGAATGGGAAAGACACAGTGA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Gabor Borbely et al.
Oncotarget, 6(32), 33623-33635 (2015-09-18)
Members of the bromodomain and extra-C terminal (BET) domain protein family and the histone deacetylase (HDAC) enzyme family regulate the expression of important oncogenes and tumor suppressor genes. Here we show that the BET inhibitor JQ1 inhibits proliferation and induces
Michelle de la Vega et al.
Nature communications, 2, 259-259 (2011-03-31)
Deubiquitinating enzymes are now emerging as potential therapeutic targets that control many cellular processes, but few have been demonstrated to control cell motility. Here, we show that ubiquitin-specific protease 17 (USP17) is rapidly and transiently induced in response to chemokines
M Mehić et al.
Oncogenesis, 6(6), e348-e348 (2017-06-13)
The levels of hyaluronan, a ubiquitous glycosaminoglycan prominent in the extracellular matrix, is balanced through the actions of hyaluronan-synthesizing enzymes (HAS1, 2 and 3) and degrading hyaluronidases (Hyal 1, 2, 3 and PH20). Hyaluronan accumulates in rapidly remodeling tissues, such
Tongzheng Liu et al.
Nature communications, 8, 13923-13923 (2017-01-10)
Tumour metastasis, the spread of cancer cells from the original tumour site followed by growth of secondary tumours at distant organs, is the primary cause of cancer-related deaths and remains poorly understood. Here we demonstrate that inhibition of CDK4/6 blocks

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.