Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU150081

Sigma-Aldrich

MISSION® esiRNA

targeting human SESN2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGCTGTGCTTTGTGGAAGACCCTACTTTCGGATATGAGGACTTCACTCGGAGAGGGGCTCAGGCACCCCCTACCTTCCGGGCCCAGGATTATACCTGGGAAGACCATGGCTACTCGCTGATCCAGCGGCTTTACCCTGAGGGTGGGCAGCTGCTGGATGAGAAGTTCCAGGCAGCCTATAGCCTCACCTACAATACCATCGCCATGCACAGTGGTGTGGACACCTCCGTGCTCCGCAGGGCCATCTGGAACTATATCCACTGCGTCTTTGGCATCAGATATGATGACTATGATTATGGGGAGGTGAACCAGCTCCTGGAGCGGAACCTCAAGGTCTATATCAAGACAGTGGCCTGCTACCCAGAGAAGACCACCCGAAGAATGTACAACCTCTTCTGGAGGCACTTCCGCCACTCAGAGAAG

N° accesso Ensembl | uomo

ENSG00000130766

N° accesso NCBI

NM_031459

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SESN2(83667) , SESN2(83667)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Azioni biochim/fisiol

SESN2 (sestrin-2) is a downstream effector of p53. It is associated with cell survival, protection and regeneration. It also plays an important role in autophagy induction and tumor suppression. Overexpression of SENS2 suppresses cancer growth. It controls cell growth and proliferation by suppressing mTORC1 (mammalian target of rapamycin complex 1) activity through an AMPK (5′ AMP-activated protein kinase)-associated mechanism. It is an antioxidant protein, and can be induced by oxidative and energetic stress.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Sestrin2: A Promising Therapeutic Target for Liver Diseases.
Kim KM
Biological & Pharmaceutical Bulletin, 38, 966-966 (2015)
An ShRNA Based Genetic Screen Identified Sesn2 as a Potential Tumor Suppressor in Lung Cancer via Suppression of Akt-mTOR-p70S6K Signaling.
Xu H
PLoS ONE, 10, e0124033-e0124033 (2015)
SESN2 correlates with advantageous prognosis in hepatocellular carcinoma.
Chen S
Diagnostic Pathology, 12, 13-13 (2017)
Mengjiao Chen et al.
Journal of cellular physiology, 236(1), 392-404 (2020-06-11)
Sestrin2 (SESN2) is a highly conservative oxidative stress protein that can regulate energy metabolism, cell proliferation, apoptosis, and mitochondria autophagy processes. It plays a role as an antioxidant in various diseases. The aims of the present study were to explore
Russell E Ericksen et al.
Cell metabolism, 29(5), 1151-1165 (2019-01-22)
Tumors display profound changes in cellular metabolism, yet how these changes aid the development and growth of tumors is not fully understood. Here we use a multi-omic approach to examine liver carcinogenesis and regeneration, and find that progressive loss of
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.