Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU138031

Sigma-Aldrich

MISSION® esiRNA

targeting human ICAM1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGCCTCAGCACGTACCTCTATAACCGCCAGCGGAAGATCAAGAAATACAGACTACAACAGGCCCAAAAAGGGACCCCCATGAAACCGAACACACAAGCCACGCCTCCCTGAACCTATCCCGGGACAGGGCCTCTTCCTCGGCCTTCCCATATTGGTGGCAGTGGTGCCACACTGAACAGAGTGGAAGACATATGCCATGCAGCTACACCTACCGGCCCTGGGACGCCGGAGGACAGGGCATTGTCCTCAGTCAGATACAACAGCATTTGGGGCCATGGTACCTGCACACCTAAAACACTAGGCCACGCATCTGATCTGTAGTCACATGACTAAGCCAAGAGGAAGGAGCAAGACTCAAGACATGATTGATGGATGTTAAAGTCTAGCCTGATGAGAGGGGAAGTGGTGGGGGAGACATAGCCCCACCATGAG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wei Gu et al.
Oncotarget, 8(67), 111882-111901 (2018-01-18)
Intercellular adhesion molecule-1 is the adhesion molecule mediating leukocyte firm adhesion to endothelial cells, plays a critical role in subsequent leukocyte transmigration. ICAM-1 is also expressed in other cells including macrophages; however, the role of this adhesion molecule in mediating
Pei-Yue Jiang et al.
American journal of translational research, 11(9), 6249-6261 (2019-10-22)
We aimed to investigate the value of cholestasis-related miRNAs in the diagnosis of intra-hepatic cholestasis of pregnancy (ICP) as well as the molecular mechanisms underlying the role of these miRNAs in the pathogenesis of ICP. In this study, electron microscopy
Dejun Xu et al.
Biological chemistry, 401(5), 601-615 (2019-12-22)
Long non-coding RNA (lncRNA) maternally expressed gene 3 (MEG3) has been identified as a regulatory molecule in angiogenesis. The goal of this study was to illustrate how MEG3 affects the angiogenesis of vascular endothelial cells. Expression of MEG3, miR-147 and
Sheng-Wei Lai et al.
Nutrients, 11(6) (2019-06-19)
Natural products have historically been regarded as an important resource of therapeutic agents. Resveratrol and melatonin have been shown to increase SIRT1 activity and stimulate deacetylation. Glioblastoma multiforme (GBM) is the deadliest of malignant types of tumor in the central
Hannah L Wiesolek et al.
The American journal of pathology, 190(4), 874-885 (2020-02-09)
Intercellular adhesion molecule-1 (ICAM-1) is up-regulated during inflammation by several cell types. ICAM-1 is best known for its role in mediating leukocyte adhesion to endothelial cells and guiding leukocytes across the vascular wall. Recently, macrophages have been shown to express

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.