Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU136211

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTTGAGGGCACATGCAGTAGATATTAATGGAAATCAAGTGGAGAACCCCATTGACATTGTCATCAATGTTATTGACATGAATGACAACAGACCTGAGTTCTTACACCAGGTTTGGAATGGGACAGTTCCTGAGGGATCAAAGCCTGGAACATATGTGATGACCGTAACAGCAATTGATGCTGACGATCCCAATGCCCTCAATGGGATGTTGAGGTACAGAATCGTGTCTCAGGCTCCAAGCACCCCTTCACCCAACATGTTTACAATCAACAATGAGACTGGTGACATCATCACAGTGGCAGCTGGACTTGATCGAGAAAAAGTGCAACAGTATACGTTAATAATTCAAGCTACAGACATGGAAGGCAATCCCACATATGGCCTTTCAAACACAGCCACGGCCGTCATCACAGTGACAGATGTCAATGACAATCCTCCAGAGTTTACTGCCATGACGTTTTATGGTGAAGTTCCTGAGAACAGGGTAGACATCATAGTAGCTAATCTAACTGTGACCGATAAGGATCAACCCCATACACCA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Hsien-Ming Wu et al.
Oncotarget, 8(3), 4410-4421 (2016-12-30)
More than 25% of patients diagnosed with endometrial carcinoma have invasive primary cancer accompanied by metastases. Growth hormone-releasing hormone (GHRH) plays an important role in reproduction. Here, we examined the effect of a GHRH antagonist on the motility of endometrial
Bo Xu et al.
Nature biotechnology (2018-11-27)
The efficacy of oncolytic herpes simplex virus (oHSV) is limited by rapid viral clearance by innate immune effector cells and poor intratumoral viral spread. We combine two approaches to overcome these barriers: inhibition of natural killer (NK) cells and enhancement
Ciqing Yang et al.
Histochemistry and cell biology, 151(3), 239-248 (2018-09-27)
N-cadherin, a member of the cadherin family, plays an important role in neural development. In addition, N-cadherin has been reported to be crucial in neuronal migration, axonal outgrowth, and axonal path-finding. However, the mechanism underlying the effects of N-cadherin in
Srikanth R Polusani et al.
Journal of cell science, 129(23), 4399-4410 (2016-11-02)
Gap junction proteins (connexins) have crucial effects on cell motility in many systems, from migration of neural crest cells to promotion of metastatic invasiveness. Here, we show that expression of Cx26 (also known as GJB2) in HeLa cells specifically enhances
Ciqing Yang et al.
Journal of molecular histology, 47(6), 541-554 (2016-09-22)
N-cadherin is a calcium-sensitive cell adhesion molecule that plays an important role in the formation of the neural circuit and the development of the nervous system. In the present study, we investigated the function of N-cadherin in cell-cell connection in

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.