Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU133481

Sigma-Aldrich

MISSION® esiRNA

targeting human TMEM173

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GATATCTGCGGCTGATCCTGCCAGAGCTCCAGGCCCGGATTCGAACTTACAATCAGCATTACAACAACCTGCTACGGGGTGCAGTGAGCCAGCGGCTGTATATTCTCCTCCCATTGGACTGTGGGGTGCCTGATAACCTGAGTATGGCTGACCCCAACATTCGCTTCCTGGATAAACTGCCCCAGCAGACCGGTGACCATGCTGGCATCAAGGATCGGGTTTACAGCAACAGCATCTATGAGCTTCTGGAGAACGGGCAGCGGGCGGGCACCTGTGTCCTGGAGTACGCCACCCCCTTGCAGACTTTGTTTGCCATGTCACAATACAGTCAAGCTGGCTTTAGCCGGGAGGATAGGCTTGAGCAGGCCAAACTCTTCTGCCGGACACTTGAGGACATCCTGGCAGATGCCCCTGAGTCTCAGAACAACTGCCGCCTCATTGCCTACCAGGAACC

N° accesso Ensembl | uomo

ENSG00000184584

N° accesso NCBI

NM_198282

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... TMEM173(340061) , TMEM173(340061)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ji-Ae Kim et al.
The Journal of investigative dermatology, 137(10), 2101-2109 (2017-06-26)
Varicella zoster virus (VZV) is a human-restricted α-herpesvirus that exhibits tropism for the skin. The VZV host receptors and downstream signaling pathways responsible for the antiviral innate immune response in the skin are not completely understood. Here, we show that
Jin-Shan Ran et al.
International journal of molecular sciences, 19(12) (2018-11-25)
Innate immunity is an essential line of defense against pathogen invasion which is gained at birth, and the mechanism involved is mainly to identify pathogen-associated molecular patterns through pattern recognition receptors. STING (stimulator of interferon genes) is a signal junction
So-Young Lee et al.
Frontiers in immunology, 10, 1735-1735 (2019-08-14)
Hepatitis B virus infection is a serious global health problem and causes life-threatening liver disease. In particular, genotype C shows high prevalence and severe liver disease compared with other genotypes. However, the underlying mechanisms regarding virological traits still remain unclear.
Li Zhou et al.
Cancer letters, 500, 163-171 (2020-12-06)
Although the combination of chemotherapy and immunotherapy is a hot topic in lung cancer, little is understood regarding the possible mechanisms behind their synergy. Moreover, safety is a major concern for clinicians while performing chemotherapy. Therefore, it is important to
Junxia Cui et al.
Fish & shellfish immunology, 68, 29-36 (2017-07-08)
In the innate immune responses in host protection, pattern recognition receptors are involve in a variety of sensing mechanisms to recognize and counter pathogen invasion. Recently, a resident endoplasmic reticulum adaptor, stimulator of interferon genes (STING) protein, also called MPYS
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.