Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU133471

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK7

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCTTGTGACCCAGCAGCTATCTAAGTCACAGGTGGAGGACCCCCTGCCCCCTGTGTTCTCAGGCACACCAAAGGGCAGTGGGGCTGGCTACGGTGTTGGCTTTGACCTGGAGGAATTCTTAAACCAGTCTTTCGACATGGGCGTGGCTGATGGGCCACAGGATGGCCAGGCAGATTCAGCCTCTCTCTCAGCCTCCCTGCTTGCTGACTGGCTCGAAGGCCATGGCATGAACCCTGCCGATATTGAGTCCCTGCAGCGTGAGATCCAGATGGACTCCCCAATGCTGCTGGCTGACCTGCCTGACCTCCAGGACCCCTGAGGCCCCCAGCCTGTGCCTTGCTGCCACAGTAGACCTAGTTCCAGGATCCATGGGAGCATTCTCAAAGGCTTTAGCCCTGGACCCAGCAGGTGAGGCTCGGCTTGGATTATTCTGCAGGTTCATCTCAGACCCACC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yan Huang et al.
Tumori, 103(5), 483-488 (2016-10-30)
Osteosarcoma (OS) is the most common primary bone tumor and has low cure rates. Our study aimed to evaluate the roles of mitogen-activated protein kinase 7 (MAPK7) in cell proliferation, migration and invasion using the SOSP-M human OS cell line
Byambasuren Vanchin et al.
The Journal of pathology, 247(4), 456-470 (2018-12-20)
Endothelial-mesenchymal transition occurs during intimal hyperplasia and neointima formation via mechanisms that are incompletely understood. Endothelial MAPK7 signaling is a key mechanosensitive factor that protects against endothelial-mesenchymal transition, but its signaling activity is lost in vessel areas that are undergoing
Abrar Ul Haq Khan et al.
Scientific reports, 7(1), 10654-10654 (2017-09-08)
Controlling cholesterol levels is a major challenge in human health, since hypercholesterolemia can lead to serious cardiovascular disease. Drugs that target carbohydrate metabolism can also modify lipid metabolism and hence cholesterol plasma levels. In this sense, dichloroacetate (DCA), a pyruvate
Abrar Ul Haq Khan et al.
Scientific reports, 8(1), 7420-7420 (2018-05-11)
Oxidative phosphorylation (OXPHOS) generates ROS as a byproduct of mitochondrial complex I activity. ROS-detoxifying enzymes are made available through the activation of their antioxidant response elements (ARE) in their gene promoters. NRF2 binds to AREs and induces this anti-oxidant response.
Dae-Hwan Nam et al.
Molecules and cells, 40(7), 457-465 (2017-07-07)
Streptozotocin (STZ)-induced murine models of type 1 diabetes have been used to examine ER stress during pancreatic β-cell apoptosis, as this ER stress plays important roles in the pathogenesis and development of the disease. However, the mechanisms linking type 1

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.