Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU124641

Sigma-Aldrich

MISSION® esiRNA

targeting human CACNA1C (1)

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCAATGCACTTGATGTGGTCTTGCACATGTGGGTGATAGAGTTGGGTTCCTTTTTATGCTGGGTGTACAGGTGGGTTTGGGAGAGAGGAGCATGCGCGAGAGAGTCTCCGAGTGTGTGCGACGCGTGTGTGTGTGGTGGGTTGTCTGTGTGCATATGTCCTGCCCGTGTATATGCACCCACACCATGTGCCCGTGCACACCAGTGACTACGCAGTCCCCCCTTTCTGGTTTAGCTGTGGGAAGATCTGAATCTGGGGCCGTTTGAAAGCAAAAACAAACCACTGTCTCTGCTTCTGAAACGG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Guillaume Jacquemet et al.
Nature communications, 7, 13297-13297 (2016-12-03)
Mounting in vitro, in vivo and clinical evidence suggest an important role for filopodia in driving cancer cell invasion. Using a high-throughput microscopic-based drug screen, we identify FDA-approved calcium channel blockers (CCBs) as potent inhibitors of filopodia formation in cancer
Hyun Su Lee et al.
Molecular medicine reports, 12(3), 4782-4788 (2015-06-24)
5‑Fluorouracil (5‑FU), one of the oldest anticancer therapeutic agents, is increasingly being administered in cancer chemotherapy. In the present study, the anticancer effects of 5‑FU combined with corosolic acid (CRA) were determined in SNU‑620 human gastric carcinoma cells and the
Hoe-Su Jeong et al.
Biochimica et biophysica acta, 1849(6), 709-721 (2015-03-01)
The ubiquitin-proteasome system (UPS) plays an important role in protein quality control, cellular signalings, and cell differentiation through the regulated turnover of key transcription factors in cardiac tissue. However, the molecular mechanism underlying Fbxo25-mediated ubiquitination of cardiac transcription factors remains
Dan Yang et al.
Cancer chemotherapy and pharmacology, 76(3), 575-586 (2015-07-26)
5-Fluorouracil (5-FU) is the basic chemotherapeutic agent used to treat colon cancer. However, the sensitivity of colon cancer cells to 5-FU is limited. Gossypol is a polyphenolic extract of cottonseeds. The purpose of this study was to investigate the activities
F Wang et al.
Acta physiologica (Oxford, England), 214(2), 261-274 (2015-04-08)
The primary aim of this study was to identify the effects of hyperammonaemia on functional expression of Cav1.2 L-type Ca(2+) channels in astroglia. Primary cultures of mouse astrocytes were used to study effects of chronic treatment (1-5 days) with ammonium

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.