Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU121701

Sigma-Aldrich

MISSION® esiRNA

targeting human RRM2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTGTGATTTTGCTTGCCTGATGTTCAAACACCTGGTACACAAACCATCGGAGGAGAGAGTAAGAGAAATAATTATCAATGCTGTTCGGATAGAACAGGAGTTCCTCACTGAGGCCTTGCCTGTGAAGCTCATTGGGATGAATTGCACTCTAATGAAGCAATACATTGAGTTTGTGGCAGACAGACTTATGCTGGAACTGGGTTTTAGCAAGGTTTTCAGAGTAGAGAACCCATTTGACTTTATGGAGAATATTTCACTGGAAGGAAAGACTAACTTCTTTGAGAAGAGAGTAGGCGAGTATCAGAGGATGGGAGTGATGTCAAGTCCAACAGAGAATTCTTTTACCTTGGATGCTGACTTCTAAATGAACTGAAGATGTGCCCTTACTTGGCTGATTTTTTTTTTCCATCTCATAAGAAAAATCAGCTGAAGTGTTACCAACTAGCCACACCATGAA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yueting Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 103, 982-988 (2018-05-02)
Peripheral vascular disease (PVD) is a prevalent vascular disease that affect a large number of patients. The establishment of optimal treatments to mitigate the intimal hyperplasia (IH)-induced restenosis would help relieve the health burden of the PVD. Ribonucleotide reductase M2
S M Du
Neoplasma, 67(3), 567-575 (2020-03-04)
Long noncoding RNAs (lncRNAs) have been suggested to play vital roles in tumor initiation and progression. Recent studies have reported that the lncRNA small nucleolar RNA host gene 16 (SNHG16) is highly expressed in breast cancer tissue. In the present
Zejun Fang et al.
Oncotarget, 7(47), 78055-78068 (2016-11-02)
As the small subunit of Ribonucleotide reductase (RR), RRM2 displays a very important role in various critical cellular processes such as cell proliferation, DNA repair, and senescence, etc. Importantly, RRM2 functions like a tumor driver in most types of cancer
Wei Kang et al.
Oncology reports, 31(6), 2579-2586 (2014-04-24)
Ribonucleotide reductase M2 subunit (RRM2) is one of the two subunits of human ribonucleotide reductase which plays a critical role in tumor progression. The aim of the present study was to analyze its expression, clinical significance and biological functions in gastric
Chunshui Liu et al.
Oncology reports, 42(2), 571-580 (2019-06-25)
Imatinib‑based targeted treatment is the standard therapy for chronic myeloid leukemia (CML); however, drug resistance is an inevitable issue for imatinib‑based CML treatment. Imatinib resistance can be ascribed to Bcr‑Abl‑dependent and independent resistance. In the present study, peripheral blood samples

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.