Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU114221

Sigma-Aldrich

MISSION® esiRNA

targeting human YY1AP1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AAGACCAAACAGCTGCCAGTCCTAGGAAAATGCTGTGAAGAGATCCAGCCACATCAGTGGAAGCCACCTATAGAGAGAGAAGAACACCGGCTCCCATTCTGGTTAAAGGCCAGTCTGCCATCCATCCAGGAAGAACTGCGGCACATGGCTGATGGTGCTAGAGAGGTAGGAAATATGACTGGAACCACTGAGATCAACTCAGATCAAGGCCTAGAAAAAGACAACTCAGAGTTGGGGAGTGAAACTCGGTACCCACTGCTATTGCCTAAGGGTGTAGTCCTGAAACTGAAGCCAGTTGCCGACCGTTTCCCCAAGAAGGCTTGGAGACAGAAGCGTTCATCAGTCCTGAAACCCCTCCTTATCCAACCCAGCCCCTCTCTCCAGCCCAGCTTCAACCCTGGGAAAACAC

N° accesso Ensembl | uomo

ENSG00000163374

N° accesso NCBI

NM_032292

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... YY1AP1(55249) , YY1AP1(55249)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Hyun-Jung Choi et al.
Nature communications, 6, 6943-6943 (2015-05-13)
Angiogenesis is regulated by the dynamic interaction between endothelial cells (ECs). Hippo-Yes-associated protein (YAP) signalling has emerged as a key pathway that controls organ size and tissue growth by mediating cell contact inhibition. However, the role of YAP in EC
David Fu et al.
Endocrine-related cancer, 21(2), 297-310 (2014-01-07)
The Hippo signaling pathway has been implicated as a conserved regulator of organ size in both Drosophila and mammals. Yes-associated protein (YAP), the central component of the Hippo signaling cascade, functions as an oncogene in several malignancies. Ovarian granulosa cell
C He et al.
Oncogene, 34(50), 6040-6054 (2015-03-24)
Mechanisms underlying ovarian cancer initiation and progression are unclear. Herein, we report that the Yes-associated protein (YAP), a major effector of the Hippo tumor suppressor pathway, interacts with ERBB signaling pathways to regulate the initiation and progression of ovarian cancer.
Upal Basu-Roy et al.
Nature communications, 6, 6411-6411 (2015-04-04)
The repressive Hippo pathway has a profound tumour suppressive role in cancer by restraining the growth-promoting function of the transcriptional coactivator, YAP. We previously showed that the stem cell transcription factor Sox2 maintains cancer stem cells (CSCs) in osteosarcomas. We
Ute Schütte et al.
Translational oncology, 7(2), 309-321 (2014-06-11)
Recent work has identified dysfunctional Hippo signaling to be involved in maintenance and progression of various human cancers, although data on clear cell renal cell carcinoma (ccRCC) have been limited. Here, we provide evidence implicating aberrant Hippo signaling in ccRCC

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.