Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU113871

Sigma-Aldrich

MISSION® esiRNA

targeting human KRT18

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CACAGTCTGCTGAGGTTGGAGCTGCTGAGACGACGCTCACAGAGCTGAGACGTACAGTCCAGTCCTTGGAGATCGACCTGGACTCCATGAGAAATCTGAAGGCCAGCTTGGAGAACAGCCTGAGGGAGGTGGAGGCCCGCTACGCCCTACAGATGGAGCAGCTCAACGGGATCCTGCTGCACCTTGAGTCAGAGCTGGCACAGACCCGGGCAGAGGGACAGCGCCAGGCCCAGGAGTATGAGGCCCTGCTGAACATCAAGGTCAAGCTGGAGGCTGAGATCGCCACCTACCGCCGCCTGCTGGAAGATGGCGAGGACTTTAATCTTGGTGATGCCTTGGACAGCAGCAACTCCATGCAAACCATCCAAAAGACCACCACCCGCCGGATAGTGGATGGCAAAGTGGTGTCTGA

N° accesso Ensembl | uomo

ENSG00000111057

N° accesso NCBI

NM_000224

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... KRT18(3875) , KRT18(3875)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Kenneth H Yu et al.
Journal of proteome research, 8(3), 1565-1576 (2009-02-10)
A novel approach to pancreatic cancer biomarker discovery has been developed, which employs a stable isotope labeled proteome (SILAP) standard coupled with extensive multidimensional separation coupled with tandem mass spectrometry (MS/MS). Secreted proteins from CAPAN-2 human pancreatic cancer derived cells
Zahra Khalaj et al.
Iranian journal of basic medical sciences, 19(1), 34-42 (2016-04-21)
The application of stem cells holds great promises in cell transplants. Considering the lack of optimal in vitro model for hepatogenic differentiation, this study was designed to examine the effects of laminin matrix on the improvement of in vitro differentiation
Christian Lehmann et al.
International journal of oncology, 41(6), 1932-1942 (2012-10-09)
The tumor-initiating capacity of primary human breast cancer cells is maintained in vitro by culturing these cells as spheres/aggregates. Inoculation of small cell numbers derived from these non-adherent cultures leads to rapid xenograft tumor formation in mice. Accordingly, injection of
Hyejung Jung et al.
Molecular and cellular biochemistry, 423(1-2), 21-28 (2016-11-04)
During epithelial-mesenchymal transition (EMT), epithelial cells lose key phenotypic markers (e.g., E-cadherin and cytokeratin 18) and acquire mesenchymal markers (e.g., N-cadherin and vimentin). Although the loss of cytokeratin 18 is a hallmark of EMT, the regulatory role of cytokeratin 18
Hyunee Yim et al.
Journal of Korean medical science, 21(4), 652-655 (2006-08-08)
Cytokeratin 18 (CK18) protein was identified as an airway epithelial cell autoantigen associated with nonallergic asthma. Cleavage of CK18 protein by caspase-3 is a marker of early apoptosis in epithelial cells. It has been shown that the expression of active
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.