Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU113511

Sigma-Aldrich

MISSION® esiRNA

targeting human BAK1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CAACCGACGCTATGACTCAGAGTTCCAGACCATGTTGCAGCACCTGCAGCCCACGGCAGAGAATGCCTATGAGTACTTCACCAAGATTGCCACCAGCCTGTTTGAGAGTGGCATCAATTGGGGCCGTGTGGTGGCTCTTCTGGGCTTCGGCTACCGTCTGGCCCTACACGTCTACCAGCATGGCCTGACTGGCTTCCTAGGCCAGGTGACCCGCTTCGTGGTCGACTTCATGCTGCATCACTGCATTGCCCGGTGGATTGCACAGAGGGGTGGCTGGGTGGCAGCCCTGAACTTGGGCAATGGTCCCATCCTGAACGTGCTGGTGGTTCTGGGTGTGGTTCTGTTGGGCCAGTTTGTGGTACGAAGATTCTTCAAATCATGACTCCCAAGGGTGCCCTTTGGGGTCCCGGTTCAGACCCCTGCCTGGACTTAAGCGAAGTCTTTGCCTTCTCTGTTCCCTTGCAG

N° accesso Ensembl | uomo

ENSG00000030110

N° accesso NCBI

NM_001188

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... BAK1(578) , BAK1(578)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Ci dispiace, ma al momento non ci sono COA disponibili online per questo prodotto.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Shunnan Yao et al.
Cancer letters, 483, 87-97 (2020-04-09)
Hepatocellular carcinoma (HCC) is a common malignancy with a poor prognosis. Dimethylaminomicheliolide (DMAMCL) is a novel antitumor agent that has been tested in phase I clinical trials; however, little is known regarding its effects in HCC. In this study, we
Chiaki Tsuge Ishida et al.
Oncotarget, 8(23), 37140-37153 (2017-04-19)
Malignant gliomas display high levels of the transcription factor c-myc and organize a tumor specific chaperone network within mitochondria. Here, we show that c-myc along with mitochondrial chaperone inhibition displays massive tumor cell death. Inhibition of mitochondrial matrix chaperones and
Haiyan Tan et al.
Oncotarget, 6(36), 39184-39195 (2015-10-10)
Prostate cancer is the second most commonly diagnosed cancer among men in the United States. Prostate cancer therapy is severely hampered by lack of response and development of resistance to conventional chemotherapeutic drugs in patients. Therefore, the development and discovery
Rong Zhang et al.
Cell death & disease, 9(6), 598-598 (2018-05-24)
Hirsutine extracted from Uncaria rhynchophylla has been shown to exhibit anti-cancer activity. However, the molecular mechanism by which hirsutine exhibits anti-lung cancer activity remains unclear. In the present study, we showed that hirsutine induces apoptosis in human lung cancer cells
Melissa Desouza-Armstrong et al.
Cytoskeleton (Hoboken, N.J.), 74(6), 233-248 (2017-04-06)
The actin cytoskeleton is a polymer system that acts both as a sensor and mediator of apoptosis. Tropomyosins (Tpm) are a family of actin binding proteins that form co-polymers with actin and diversify actin filament function. Previous studies have shown
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.