Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU112661

Sigma-Aldrich

MISSION® esiRNA

targeting human BNIP3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTGGACGGAGTAGCTCCAAGAGCTCTCACTGTGACAGCCCACCTCGCTCGCAGACACCACAAGATACCAACAGAGCTTCTGAAACAGATACCCATAGCATTGGAGAGAAAAACAGCTCACAGTCTGAGGAAGATGATATTGAAAGAAGGAAAGAAGTTGAAAGCATCTTGAAGAAAAACTCAGATTGGATATGGGATTGGTCAAGTCGGCCGGAAAATATTCCCCCCAAGGAGTTCCTCTTTAAACACCCGAAGCGCACGGCCACCCTCAGCATGAGGAACACGAGCGTCATGAAGAAAGGGGGCATATTCTCTGCAGAATTTCTGAAAGTTTTCCTTCCATCTCTGCTGCT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xianjie Li et al.
International journal of molecular medicine, 46(2), 729-739 (2020-07-07)
Long non‑coding RNA (lncRNA) DGCR5 has been identified as a tumor suppressor in several types of cancer. However, its biological functions in pancreatic cancer (PaCa) have not yet been fully elucidated. The present study was designed to investigate the role
Yanan Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 120, 109464-109464 (2019-10-08)
The study was established to inquire into the protective effect of the HIF-1α (Hypoxia-inducible factor-1α)/ BNIP3(Bcl-2/adenovirus E1B 19-kDa interacting protein) signal path-induced-autophagy during myocardial ischemia/ reperfusion (I/R) and oxygen-glucose deprivation/recovery (OGD/R) injury in heart-derived H9C2 cells as well as its
Zhiliang He et al.
Acta biochimica et biophysica Sinica, 49(1), 25-32 (2016-11-20)
Nutrition deficiency is reported to induce apoptosis of chondrocytes and degeneration of cartilage endplate (CEP) in rabbit. Cartilage endplate stem cells (CESCs) are important for the integrity of structure and function of CEP. Bcl-2/adenovirus E1B 19-kDa-interacting protein 3 (BNIP3) has
Zong-Jie Fu et al.
Redox biology, 36, 101671-101671 (2020-08-24)
In the present study, we hypothesized that hypoxia-inducible factor 1α (HIF-1α)-mediated mitophagy plays a protective role in ischemia/reperfusion (I/R)-induced acute kidney injury (AKI). Mitophagy was evaluated by measuring the changes of mitophagy flux, mitochondria DNA copy number, and the changes
Jie Liu et al.
Molecular medicine reports, 16(5), 7253-7260 (2017-09-26)
Nutrient deprivation (ND)‑induced nucleus pulposus (NP) cell death serves an important role in intervertebral disc degeneration disease. However, the underlying mechanisms have yet to be thoroughly elucidated. The present study created a cell culture model under ND conditions to investigate

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.