Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU110781

Sigma-Aldrich

MISSION® esiRNA

targeting human FEN1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GATGTGCTGCAGAATGAGGAGGGTGAGACCACCAGCCACCTGATGGGCATGTTCTACCGCACCATTCGCATGATGGAGAACGGCATCAAGCCCGTGTATGTCTTTGATGGCAAGCCGCCACAGCTCAAGTCAGGCGAGCTGGCCAAACGCAGTGAGCGGCGGGCTGAGGCAGAGAAGCAGCTGCAGCAGGCTCAGGCTGCTGGGGCCGAGCAGGAGGTGGAAAAATTCACTAAGCGGCTGGTGAAGGTCACTAAGCAGCACAATGATGAGTGCAAACATCTGCTGAGCCTCATGGGCATCCCTTATCTTGATGCACCCAGTGAGGCAGAGGCCAGCTGTGCTGCCCTGGTGAAGGCTGGCAAAGTCTATGCTGCGGCTACCGAGGACATGGACTGCCTCACCTT

N° accesso Ensembl | uomo

ENSG00000168496

N° accesso NCBI

NM_004111

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FEN1(2237) , FEN1(2237)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Song-Bai Liu et al.
Combinatorial chemistry & high throughput screening, 22(6), 379-386 (2019-07-06)
Flap endonuclease-1 (FEN1) plays a central role in DNA replication and DNA damage repair process. In mammals, FEN1 functional sites variation is related to cancer and chronic inflammation, and supports the role of FEN1 as a tumor suppressor. However, FEN1
Xue Zeng et al.
Experimental and therapeutic medicine, 14(4), 3265-3272 (2017-09-16)
Trastuzumab has been widely applied as a treatment for human epidermal growth factor 2 (HER2)-overexpressing breast cancer. However, the therapeutic efficacy of trastuzumab is limited. Flap endonuclease 1 (FEN1) is a multifunctional endonuclease that has a crucial role in DNA
Keqiang Zhang et al.
The American journal of pathology, 188(1), 242-251 (2017-10-19)
Flap endonuclease 1 (FEN1) plays a crucial role in both DNA replication and damage repair. In this study, FEN1 expression and its clinical-pathologic significance in non-small-cell lung cancer (NSCLC) was investigated. Quantitative RT-PCR and immunohistochemistry analysis identified that both FEN1
Xue Zeng et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(10), 10717-10730 (2019-07-04)
Flap endonuclease 1 (FEN1) is recognized as a pivotal factor in DNA replication, long-patch excision repair, and telomere maintenance. Excessive FEN1 expression has been reported to be closely associated with cancer progression, but the specific mechanism has not yet been
Y Wang et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 21(8), 1026-1033 (2019-02-04)
Flap endonuclease 1 (FEN1) is up-regulated by estrogen (17β-estradiol, E2) and related to cisplatin resistance of human breast cancer cells. Letrozole, an aromatase inhibitor, suppresses the change of testosterone into estrogen and is frequently used to treat breast cancer. However
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.