Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU107721

Sigma-Aldrich

MISSION® esiRNA

targeting human HSF1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATTCCCTCCTTGCTCGAGATGGATCTGCCCGTGGGCCCCGGCGCGGCGGGGCCCAGCAACGTCCCGGCCTTCCTGACCAAGCTGTGGACCCTCGTGAGCGACCCGGACACCGACGCGCTCATCTGCTGGAGCCCGAGCGGGAACAGCTTCCACGTGTTCGACCAGGGCCAGTTTGCCAAGGAGGTGCTGCCCAAGTACTTCAAGCACAACAACATGGCCAGCTTCGTGCGGCAGCTCAACATGTATGGCTTCCGGAAAGTGGTCCACATCGAGCAGGGCGGCCTGGTCAAGCCAGAGAGAGACGACACGGAGTTCCAGCACCCATGCTTCCTGCGTGGCCAGGAGCAGCTCCTTGAGAACATCAAGAGGAAAGTGACCAGTGTGTCCACCCTGAAGAGTGAAGACATAAAGATCCGCCAGGA

N° accesso Ensembl | uomo

ENSG00000185122

N° accesso NCBI

NM_005526

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... HSF1(3297) , HSF1(3297)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
XDV
EDV
UEU
WQS
FQR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Seok Jun Kim et al.
Yonsei medical journal, 59(9), 1041-1048 (2018-10-18)
Heat shock factor 1 (HSF1) is a key regulator of the heat shock response and plays an important role in various cancers. However, the role of HSF1 in gastric cancer is still unknown. The present study evaluated the function of
Liang Chen et al.
Cell cycle (Georgetown, Tex.), 18(1), 60-68 (2018-12-20)
Cells mainly rely on stress proteins, such as heat-shock proteins (HSPs), to respond to various proteotoxic conditions. These proteins protect tumor cells and enhance their survive. However, the regulation of stress proteins involved in protein quality control (PQC) is still
Antonio Cigliano et al.
Oncotarget, 8(33), 54149-54159 (2017-09-15)
Upregulation of the heat shock transcription factor 1 (HSF1) has been described as a frequent event in many cancer types, but its oncogenic role in hepatocellular carcinoma (HCC) remains poorly delineated. In the present study, we assessed the function(s) of
Ye-Ji Jeong et al.
PloS one, 10(6), e0128552-e0128552 (2015-06-02)
Radiation enteropathy is a common complication in cancer patients. The aim of this study was to investigate whether radiation-induced intestinal injury could be alleviated by coniferyl aldehyde (CA), an HSF1-inducing agent that increases cellular HSP70 expression. We systemically administered CA
Jacqueline H L Fok et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(10), 2395-2407 (2018-02-03)
Purpose: Myeloma is a plasma cell malignancy characterized by the overproduction of immunoglobulin, and is therefore susceptible to therapies targeting protein homeostasis. We hypothesized that heat shock factor 1 (HSF1) was an attractive therapeutic target for myeloma due to its
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.