Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU107101

Sigma-Aldrich

MISSION® esiRNA

targeting human PPIA

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACCATTGCTGACTGTGGACAACTCGAATAAGTTTGACTTGTGTTTTATCTTAACCACCAGATCATTCCTTCTGTAGCTCAGGAGAGCACCCCTCCACCCCATTTGCTCGCAGTATCCTAGAATCTTTGTGCTCTCGCTGCAGTTCCCTTTGGGTTCCATGTTTTCCTTGTTCCCTCCCATGCCTAGCTGGATTGCAGAGTTAAGTTTATGATTATGAAATAAAAACTAAATAACAATTGTCCTCGTTTGAGTTAAGAGTGTTGATGTAGGCTTTATTTTAAGCAGTAATGGGTTACTTCTGAAACATCACTTGTTTGCTTAATTCTACACAGTACTTAGATTTTTTTTACTTTCCAGTCCCAGGAAGTGTCAATGTTTGTTGAGTGGAATATTGAAAATGTAGGCAGCAACTGGG

N° accesso Ensembl | uomo

ENSG00000196262

N° accesso NCBI

NM_021130

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PPIA(5478) , PPIA(5478)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

N Doti et al.
Cell death & disease, 5, e993-e993 (2014-01-18)
Delayed neuronal cell death largely contributes to the progressive infarct development and associated functional impairments after cerebral ischemia or brain trauma. Previous studies exposed a key role for the interaction of the mitochondrial protein apoptosis-inducing factor (AIF) and cytosolic cyclophilin
Hiroya Fujioka et al.
Oncology letters, 13(1), 289-295 (2017-01-27)
Paclitaxel is widely used to treat various cancers; however, resistance to this drug is a major obstacle to breast cancer chemotherapy. To identify the proteins involved in paclitaxel resistance, the present study compared the proteomes of MCF-7 human breast cancer
Hiroaki Takeuchi et al.
Retrovirology, 9, 3-3 (2012-01-10)
An understanding of host cell factors that affect viral replication contributes to elucidation of the mechanism for determination of viral tropism. Cyclophilin A (CypA), a peptidyl-prolyl cis-trans isomerase (PPIase), is a host factor essential for efficient replication of human immunodeficiency
Zhi-Ying Qi et al.
Journal of ovarian research, 12(1), 118-118 (2019-12-01)
Ovarian cancer (OC) is a type of gynaecological malignancy with high mortality in females. Serous ovarian cancer (SOC) is a distinct subtype of OC with poor early diagnosis. Given the limitations of traditional therapies, such as chemotherapy, targeted treatment is
Huan Zhang et al.
PloS one, 9(3), e92824-e92824 (2014-03-26)
Hypoxia-inducible factor-1α (HIF-1α) is a highly important transcription factor involved in cell metabolism. HIF-1α promotes glycolysis and inhibits of mitochondrial respiration in pancreatic ductal adenocarcinoma (PDAC). In response to tumor hypoxia, cyclophilin A (CypA) is over-expressed in various cancer types
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.