Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU106991

Sigma-Aldrich

MISSION® esiRNA

targeting human UQCRFS1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGAAATTGAGCAGGAAGCTGCAGTTGAATTATCACAGTTGAGGGACCCACAGCATGATCTAGATCGAGTAAAGAAACCTGAATGGGTTATCCTGATAGGTGTTTGCACTCATCTTGGCTGTGTACCCATTGCAAATGCAGGAGATTTTGGTGGTTATTACTGCCCTTGCCATGGGTCACACTATGATGCATCTGGCAGGATCAGATTGGGTCCTGCTCCTCTCAACCTTGAAGTCCCCACGTATGAGTTCACCAGTGACGATATGGTGATTGTTGGTTAAGAGACTTGGACTCAAGTCATAGGCTTCTTTCAGTCTTTATGTCACCTCAGGAGACTTATTTGAGAGGAAGCCTTCTGTACTTGAAGTTGATTTGAAATATGTAAGAATTGATGATGTATTTGCAAACATTAATGTGAAATAAATTGAATTTAATGTTGAATACTTTCAGGCATTCACTTAATAAAGACACTGTTAAGCACTGTTATGCTCAGTCATACACGCGAAA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Zhao Yang et al.
Antioxidants & redox signaling, 32(7), 447-462 (2019-08-29)
Aims: It is known that mitochondrial reactive oxygen species generation ([ROS]m) causes the release of Ca2+via ryanodine receptor-2 (RyR2)
Lin Mei et al.
Nature communications, 11(1), 3527-3527 (2020-07-17)
Ca2+ signaling in pulmonary arterial smooth muscle cells (PASMCs) plays an important role in pulmonary hypertension (PH). However, the underlying specific ion channel mechanisms remain largely unknown. Here, we report ryanodine receptor (RyR) channel activity and Ca2+ release both are
Yoshiko Kaku et al.
Cellular signalling, 27(9), 1713-1719 (2015-05-26)
The present study investigated 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE)-induced cell death in malignant pleural mesothelioma (MPM) cells. DAPE reduced cell viability in NCI-H28, NCI-H2052, NCI-H2452, and MSTO-211H MPM cell lines in a concentration (1-100μM)-dependent manner. In the flow cytometry using propidium iodide (PI)
W He et al.
Oncogene, 33(23), 3004-3013 (2013-07-09)
Killing cancer cells through the induction of apoptosis is one of the main mechanisms of chemotherapy. However, numerous cancer cells have primary or acquired apoptosis resistance, resulting in chemoresistance. In this study, using a novel chalcone derivative chalcone-24 (Chal-24), we
H Schoeneberger et al.
Oncogene, 34(31), 4032-4043 (2014-11-11)
Evasion of apoptosis in pediatric acute lymphoblastic leukemia (ALL) is linked to aberrant expression of inhibitor of apoptosis (IAP) proteins and dysregulated redox homeostasis, rendering leukemic cells vulnerable to redox-targeting therapies. Here we discover that inhibition of antioxidant defenses via

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.