Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU105821

Sigma-Aldrich

MISSION® esiRNA

targeting human MST1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCCAGTAGCCAAGATGGTGTGTGGGCCCTCAGGCTCCCAGCTTGTCCTGCTCAAGCTGGAGAGATCTGTGACCCTGAACCAGCGTGTGGCCCTGATCTGCCTGCCCCCTGAATGGTATGTGGTGCCTCCAGGGACCAAGTGTGAGATTGCAGGCTGGGGTGAGACCAAAGGTACGGGTAATGACACAGTCCTAAATGTGGCCTTGCTGAATGTCATCTCCAACCAGGAGTGTAACATCAAGCACCGAGGACGTGTGCGGGAGAGTGAGATGTGCACTGAGGGACTGTTGGCCCCTGTGGGGGCCTGTGAGGGTGACTACGGGGGCCCACTTGCCTGCTTTACCCACAACTGCTGGGTCCTGGAAGGAATTATAATCCCCAACCGAGTATGCGCAAGGTCCCGCTGGCCAGCTGTCTTCACGCGTGTCTCTGTGT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Li Chen et al.
International journal of clinical and experimental pathology, 8(9), 10545-10554 (2015-12-01)
E2F transcription factors regulate a wide range of biological processes, including cell cycle, apoptosis and DNA damage response. In the present study, we examined whether E2F2 is related to the poor prognosis of NSCLC and its role in progress of
Zheng-Qing Fang et al.
Journal of cellular biochemistry, 119(10), 8317-8324 (2018-06-23)
We intended to evaluate miR-490-5p expression in hepatocellular carcinoma (HCC) tissues and detect the potential targets of miR-490-5p. In vitro experiments were conducted to further investigate the biological function of miR-490-5p on HCC cell metastasis. We investigated the abnormally expressed
Shiguan Wang et al.
Arthritis research & therapy, 20(1), 225-225 (2018-10-06)
Expression of E2F transcription factor 2 (E2F2), a transcription factor related to the cell cycle, is abnormally high in rheumatoid arthritis synovial fibroblasts (RASFs). Deregulated expression of E2F2 leads to abnormal production of proinflammatory cytokines, such as interleukin (IL)-1α, IL-1β
Trang Nguyen-Vu et al.
Breast cancer research : BCR, 15(3), R51-R51 (2013-07-03)
Liver × receptors (LXRs) are members of the nuclear receptor family of ligand-dependent transcription factors and have established functions as regulators of cholesterol, glucose, and fatty acid metabolism and inflammatory responses. Published reports of anti-proliferative effects of synthetic LXR ligands
Hang Song et al.
Journal of physiology and biochemistry, 72(4), 733-744 (2016-08-16)
Glioblastoma multiforme (GBM), the most common and lethal primary brain tumor in adults characterized by high proliferative ability and mortality rate, contains a small subpopulation of cancer stem-like cells (CSCs), which is responsible for GBM progression and therapeutic resistance. Numerous

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.