Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU094321

Sigma-Aldrich

MISSION® esiRNA

targeting human WNK1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACCACTTCATTCCCAAGCACAGCTTCACAGCTGTGCATTCAGCTTAGCAGCAGTACTTCTACTCCTACTTTAGCTGAAACCGTGGTAGTTAGCGCACACTCACTAGATAAGACATCTCATAGCAGTACAACTGGATTGGCTTTCTCCCTCTCTGCACCATCTTCCTCTTCCTCTCCTGGAGCAGGAGTGTCTAGTTATATTTCTCAGCCTGGTGGGCTGCATCCTTTGGTCATTCCATCAGTGATAGCTTCTACTCCTATTCTTCCCCAAGCAGCAGGACCTACTTCTACACCTTTATTACCCCAAGTACCTAGTATCCCACCCTTGGTACAGCCTGTTGCCAATGTGCCTGCTGTACAGCAGACACTAATTCATAGTCAGCCTCAACCAGCTTTGCTTCCCAACCAGCCCCATACTCATTG

N° accesso Ensembl | uomo

ENSG00000060237

N° accesso NCBI

NM_018979

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... WNK1(65125) , WNK1(65125)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Sukanya Shyamasundar et al.
International journal of oncology, 49(6), 2629-2636 (2016-11-15)
Despite advances in treatment, the highly metastatic nature of breast tumors has given rise to the urgent need for development of novel therapeutic and prognostic markers. miR-93 is known to regulate the epithelial to mesenchymal transition process and to influence
Hui Dong et al.
Journal of cellular physiology, 235(10), 6548-6562 (2020-02-19)
Long noncoding RNAs (lncRNAs) have been recognized as cancer-associated biological molecules, favoring hepatocellular carcinoma (HCC) progression. This study was conducted to elucidate the effects lncRNA lymphoid enhancer-binding Factor 1 antisense RNA (LEF1-AS1) on the pathological development of HCC, along with
Jen-Yu Hung et al.
Oncotarget, 8(38), 63691-63702 (2017-10-04)
The extracellular matrix is a component of physiological microenvironment and a regulator of cellular processes such as migration and proliferation. Secreted Protein Acidic and Rich in Cysteine (SPARC/osteonectin) is an extracellular matrix-associated glycoprotein involved in the regulation of cell proliferation
Jian-Ling Gao et al.
The journal of pain : official journal of the American Pain Society, 20(12), 1416-1428 (2019-05-16)
Our preliminary experiment indicated the activation of with-nolysine kinases 1 (WNK1) in bone cancer pain (BCP) rats. This study aimed to investigate the underlying mechanisms via which WNK1 contributed to BCP. A rat model of BCP was induced by Walker-256
Perrine Friedel et al.
Science signaling, 8(383), ra65-ra65 (2015-07-02)
Activation of Cl(-)-permeable γ-aminobutyric acid type A (GABAA) receptors elicits synaptic inhibition in mature neurons but excitation in immature neurons. This developmental "switch" in the GABA function depends on a postnatal decrease in intraneuronal Cl(-) concentration mediated by KCC2, a

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.