Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU093591

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GAAACTGGGAAGCTTGATGGACCAGACAAATAGGATGATGGCTGCCCCCACACAATAAATGGTAACATAGGAGACATCCACATCCCAATTCTGACAAGACCTCATGCCTGAAGACAGCTTGGGCAGGTGAAACCAGAATATGTGAACTGAGTGGACACCCGAGGCTGCCACTGGAATGTCTTCTCAGGCCATGAGCTGCAGTGACTGGTAGGGCTGTGTTTACAGTCAGGGCCACCCCGTCACATATACAAAGGAGCTGCCTGCCTGTTTGCTGTGTTGAACTCTTCACTCTGCTGAAGCTCCTAATGGAAAAAGCTTTCTTCTGACTGTGACCCTCTTGAACTGAATCAGACCAACTGGAATCCCAGA

N° accesso Ensembl | uomo

ENSG00000142082

N° accesso NCBI

NM_012239

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SIRT3(23410) , SIRT3(23410)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Applicazioni

MISSION® esiRNA has been used for transfection of cells to target SIRT3.

Azioni biochim/fisiol

SIRT3 (sirtuin 3) is a mitochondrial deacetylase, which acts as an oncogene. It is associated with the initiation and progression of certain cancers. However, in some cases it also works anti-oncogenically. It plays a major role in mitochondrial activity via deacetylating proteins associated with energy metabolism, ATP generation, redox optimization, and mitochondrial biogenesis. It is also involved in transcription, insulin secretion and apoptosis. Deacetylation of cyclophilin-D via SIRT3 inhibits age-associated cardiac hypertrophy. SIRT3 also exhibits neuroprotective roles.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
BDV
HYU
ZXU
QWU
CWU

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Mitochondrial SIRT3 mediates adaptive responses of neurons to exercise and metabolic and excitatory challenges.
Cheng A
Cell Metabolism, 23, 128-142 (2016)
Xiaokan Zhang et al.
Circulation, 137(19), 2052-2067 (2018-01-14)
Heart failure leads to mitochondrial dysfunction and metabolic abnormalities of the failing myocardium coupled with an energy-depleted state and cardiac remodeling. The mitochondrial deacetylase sirtuin 3 (SIRT3) plays a pivotal role in the maintenance of mitochondrial function through regulating the
Chao Song et al.
Free radical biology & medicine, 112, 616-630 (2017-09-16)
Mitochondrial reactive oxygen species (ROS) production has been implicated in the pathogenesis of fluoride toxicity in liver. Melatonin, an indolamine synthesized in the pineal gland, was previously shown to protect against sodium fluoride (NaF)-induced hepatotoxicity. This study investigated the protective
Cai Shumin et al.
Cell death discovery, 4, 52-52 (2018-05-16)
Genipin (GP) is commonly used to treat cardiovascular diseases; however, the protective action of GP against vascular hyperpermeability (VH) has not been reported. We previously reported that intrinsic apoptotic signaling (IAS) is involved in VH following hemorrhagic shock (HS). GP
Pro-Proliferative Function of Mitochondrial Sirtuin Deacetylase SIRT3 in Human Melanoma.
George J
The Journal of Investigative Dermatology, 136, 809-809 (2016)
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.