Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU092971

Sigma-Aldrich

MISSION® esiRNA

targeting human CD151

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AACACGGAGCTCAAGGAGAACCTGAAGGACACCATGACCAAGCGCTACCACCAGCCGGGCCATGAGGCTGTGACCAGCGCTGTGGACCAGCTGCAGCAGGAGTTCCACTGCTGTGGCAGCAACAACTCACAGGACTGGCGAGACAGTGAGTGGATCCGCTCACAGGAGGCCGGTGGCCGTGTGGTCCCAGACAGCTGCTGCAAGACGGTGGTGGCTCTTTGTGGGCAGCGAGACCATGCCTCCAACATCTACAAGGTGGAGGGCGGCTGCATCACCAAGTTGGAGACCTTCATCCAGGAGCACCTGAGGGTCATTGGGGCTGTGGGGATCGGCATTGCCTGTGTGCAGGTCTTTGGCATGATCTTCACGTGCTGCCTGTAC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Laura A Fast et al.
International journal of molecular sciences, 19(10) (2018-10-04)
Tetraspanins are suggested to regulate the composition of cell membrane components and control intracellular transport, which leaves them vulnerable to utilization by pathogens such as human papillomaviruses (HPV) and cytomegaloviruses (HCMV) to facilitate host cell entry and subsequent infection. In
Yongkang Qiao et al.
The Journal of allergy and clinical immunology, 139(1), 82-92 (2016-05-29)
Airway smooth muscle (ASM) contraction underpins airway constriction; however, underlying mechanisms for airway hyperresponsiveness (AHR) remain incompletely defined. CD151, a 4-transmembrane glycoprotein that associates with laminin-binding integrins, is highly expressed in the human lung. The role of CD151 in ASM
Yongkang Qiao et al.
The Journal of allergy and clinical immunology, 141(5), 1799-1817 (2017-12-24)
Despite advances in our understanding of the mechanisms of influenza A virus (IAV) infection, the crucial virus-host interactions during the viral replication cycle still remain incomplete. Tetraspanin CD151 is highly expressed in the human respiratory tract, but its pathological role in
Soonyean Hwang et al.
Cellular and molecular life sciences : CMLS, 76(8), 1595-1604 (2019-02-20)
Tetraspanin protein CD151 has typically been studied as binding partner and functional regulator of laminin-binding integrins. However, we show here that CD151 supports anti-cancer drug resistance independent of integrins. CD151 ablation sensitized multiple tumor cell types to several anti-cancer drugs
Jérôme Finke et al.
Scientific reports, 10(1), 5356-5356 (2020-03-27)
During cell invasion, human papillomaviruses use large CD151 patches on the cell surface. Here, we studied whether these patches are defined architectures with features for virus binding and/or internalization. Super-resolution microscopy reveals that the patches are assemblies of closely associated

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.