Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU091861

Sigma-Aldrich

MISSION® esiRNA

targeting human ENG

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CATGCAGATCTGGACCACTGGAGAATACTCCTTCAAGATCTTTCCAGAGAAAAACATTCGTGGCTTCAAGCTCCCAGACACACCTCAAGGCCTCCTGGGGGAGGCCCGGATGCTCAATGCCAGCATTGTGGCATCCTTCGTGGAGCTACCGCTGGCCAGCATTGTCTCACTTCATGCCTCCAGCTGCGGTGGTAGGCTGCAGACCTCACCCGCACCGATCCAGACCACTCCTCCCAAGGACACTTGTAGCCCGGAGCTGCTCATGTCCTTGATCCAGACAAAGTGTGCCGACGACGCCATGACCCTGGTACTAAAGAAAGAGCTTGTTGCGCATTTGAAGTGCACCATCACGGGCCTGACCTTCTGGGACCCCAGCTGTGAGGCAGAGGACAGGGGTGACAAGTTTGTCTTGCGCAGTGCTTACT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Shoumei Bai et al.
Cancers, 11(11) (2019-11-07)
: Most high-grade serous ovarian cancers (HGSCs) initiate from the fallopian tube epithelium and then metastasize to the ovary and throughout the abdomen. Genomic analyses suggest that most HGSCs seed the ovary prior to abdominal dissemination. Similarly, animal models support
Elisa Rossi et al.
Cellular and molecular life sciences : CMLS, 73(8), 1715-1739 (2015-12-10)
The circulatory system is walled off by different cell types, including vascular mural cells and podocytes. The interaction and interplay between endothelial cells (ECs) and mural cells, such as vascular smooth muscle cells or pericytes, play a pivotal role in
Krishnendu Pal et al.
Molecular cancer therapeutics, 13(10), 2264-2275 (2014-08-16)
Endoglin, a 180-kDa disulfide-linked homodimeric transmembrane receptor protein mostly expressed in tumor-associated endothelial cells, is an endogenous binding partner of GAIP-interacting protein, C terminus (GIPC). Endoglin functions as a coreceptor of TβRII that binds TGFβ and is important for vascular
Priyanka Singh et al.
Cancer research, 78(11), 2978-2989 (2018-03-15)
Inhibin is a heterodimeric TGFβ family ligand that is expressed in many cancers and is a selective biomarker for ovarian cancers; however, its tumor-specific functions remain unknown. Here, we demonstrate that the α subunit of inhibin (INHA), which is critical
Caixia Yuan et al.
Experimental and therapeutic medicine, 17(4), 2547-2556 (2019-03-25)
Bone morphogenetic protein (BMP) expression has been observed in the uterus in previous studies. However, the influence of BMP7 on blastocyst implantation remains unclear. Blastocysts first act on luminal endometrial epithelial cells during implantation. The purpose of the present study

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.